>gb|AE006100.1| Pasteurella multocida subsp. multocida str. Pm70 section 67 of 204 of
            the complete genome
          Length = 13317

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 239  aagttcatgatgcattctaca 259
            |||||||||||||||||||||
Sbjct: 5082 aagttcatgatgcattctaca 5062

>gb|AE006850.1| Sulfolobus solfataricus P2 section 209 of 272 of the complete genome
          Length = 10755

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 209  acatcagcattccaacacttatta 232
            |||| |||||||||||||||||||
Sbjct: 5640 acatgagcattccaacacttatta 5617

>gb|AC006044.2| Homo sapiens BAC clone RP11-539B24 from 7, complete sequence
          Length = 141509

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 221   caacacttattatatagaaa 240
             ||||||||||||||||||||
Sbjct: 72053 caacacttattatatagaaa 72072

>emb|AL358073.24| Human DNA sequence from clone RP11-458I7 on chromosome 1 Contains the
             5' end of the ZA20D1 gene for zinc finger, A20 domain
             containing 1, a ribosomal protein L6 (RPL6) pseudogene,
             the VPS45A gene for vacuolar protein sorting 45A (yeast),
             the gene for CK2 interacting protein 1; HQ0024c protein
             (CKIP-1), a novel gene and a CpG island, complete sequence
          Length = 188211

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 217   attccaacacttattatatagaaa 240
             ||||||| ||||||||||||||||
Sbjct: 53879 attccaagacttattatatagaaa 53856

>gb|AC099525.5| Papio anubis clone RP41-277O17, complete sequence
          Length = 163567

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 221   caacacttattatatagaaa 240
             ||||||||||||||||||||
Sbjct: 48481 caacacttattatatagaaa 48500

>gb|AC131156.6| Homo sapiens 3 BAC RP11-78H24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 34123

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     ttattagctcaaatgtcaac 23
             ||||||||||||||||||||
Sbjct: 17337 ttattagctcaaatgtcaac 17318

>emb|AL772382.29| Zebrafish DNA sequence from clone CH211-194E18 in linkage group 6,
             complete sequence
          Length = 97318

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 228   tattatatagaaagttcatgatgcattc 255
             ||||||||||||| ||||| ||||||||
Sbjct: 10019 tattatatagaaatttcataatgcattc 10046

>emb|BX649544.12| Zebrafish DNA sequence from clone CH211-123F23 in linkage group 9,
             complete sequence
          Length = 168473

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    gctcaaatgtcaacaaagca 29
             ||||||||||||||||||||
Sbjct: 51627 gctcaaatgtcaacaaagca 51608

>emb|AL831730.18| Zebrafish DNA sequence from clone DKEY-76A17 in linkage group 6, complete
              sequence
          Length = 159826

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 228    tattatatagaaagttcatgatgcattc 255
              ||||||||||||| ||||| ||||||||
Sbjct: 118226 tattatatagaaatttcataatgcattc 118199

>gb|AC016576.8| Homo sapiens chromosome 5 clone CTB-51A17, complete sequence
          Length = 202302

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    aagggggataaaatgtgtga 152
              ||||||||||||||||||||
Sbjct: 103805 aagggggataaaatgtgtga 103786

>emb|AJ296029.1|SSO296029 Sulfolobus solfataricus celS gene for cellulase
          Length = 1117

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 209 acatcagcattccaacacttatta 232
           |||| |||||||||||||||||||
Sbjct: 792 acatgagcattccaacacttatta 815


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,231,190
Number of Sequences: 3902068
Number of extensions: 3231190
Number of successful extensions: 53660
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53642
Number of HSP's gapped (non-prelim): 18
length of query: 422
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 400
effective length of database: 17,147,199,772
effective search space: 6858879908800
effective search space used: 6858879908800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)