ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl46f08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE014852.2| Plasmodium falciparum 3D7 chromosome 12, section ... 40 4.7
2emb|AL392184.7| Human DNA sequence from clone RP3-382B1 on chrom... 40 4.7
3emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on ch... 40 4.7
4emb|BX294134.1| Pirellula sp. strain 1 complete genome; segment ... 40 4.7
5gb|AC156611.10| Mus musculus chromosome 5, clone RP23-163P2, com... 40 4.7
6emb|BX324004.6| Zebrafish DNA sequence from clone CH211-284O17 i... 40 4.7
7dbj|AK140922.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 4.7
8gb|AC090950.3| Homo sapiens chromosome 3 clone RP11-44D5 map 3p,... 40 4.7
9dbj|AK090011.1| Mus musculus RCB-0464 Meth-A cDNA, RIKEN full-le... 40 4.7
10gb|AC007256.5| Homo sapiens BAC clone RP11-575C6 from 2, complet... 40 4.7
11gb|AC148019.5| Mus musculus BAC clone RP23-12B6 from chromosome ... 40 4.7
12emb|AL954339.10| Zebrafish DNA sequence from clone CH211-221J21 ... 40 4.7
13gb|DQ355026.1| Homo sapiens caspase 8, apoptosis-related cystein... 40 4.7
14emb|AL117192.5|CNS01DRE Human chromosome 14 DNA sequence BAC R-8... 40 4.7
15gb|AC154200.1| Mus musculus BAC clone RP24-81G10 from 17, comple... 40 4.7
16gb|AC102056.17| Mus musculus chromosome 5, clone RP23-190H2, com... 40 4.7

>gb|AE014852.2| Plasmodium falciparum 3D7 chromosome 12, section 9 of 9 of the complete
              sequence
          Length = 260929

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    aaagcaacaaacatagctgc 156
              ||||||||||||||||||||
Sbjct: 204833 aaagcaacaaacatagctgc 204852



to top

>emb|AL392184.7| Human DNA sequence from clone RP3-382B1 on chromosome 6 Contains part
            of the gene for phenylalanine-tRNA synthetase (FARS1),
            complete sequence
          Length = 42892

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 281  caccaacaacagaaaaccct 300
            ||||||||||||||||||||
Sbjct: 7580 caccaacaacagaaaaccct 7561



to top

>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part
              of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG
              island, complete sequence
          Length = 162575

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     cagagtgcagcccaagggcg 84
              ||||||||||||||||||||
Sbjct: 132033 cagagtgcagcccaagggcg 132014



to top

>emb|BX294134.1| Pirellula sp. strain 1 complete genome; segment 2/24
          Length = 304450

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 8      aaagagtacctgcgttttct 27
              ||||||||||||||||||||
Sbjct: 277498 aaagagtacctgcgttttct 277517



to top

>gb|AC156611.10| Mus musculus chromosome 5, clone RP23-163P2, complete sequence
          Length = 200155

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 128    gaaaaggtaaaagcaacaaa 147
              ||||||||||||||||||||
Sbjct: 154534 gaaaaggtaaaagcaacaaa 154515



to top

>emb|BX324004.6| Zebrafish DNA sequence from clone CH211-284O17 in linkage group 12,
             complete sequence
          Length = 136645

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 266   taggtggggcaatggcacca 285
             ||||||||||||||||||||
Sbjct: 52065 taggtggggcaatggcacca 52084



to top

>dbj|AK140922.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130072C02 product:unclassifiable, full
            insert sequence
          Length = 4219

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 130  aaaggtaaaagcaacaaaca 149
            ||||||||||||||||||||
Sbjct: 3333 aaaggtaaaagcaacaaaca 3314



to top

>gb|AC090950.3| Homo sapiens chromosome 3 clone RP11-44D5 map 3p, complete sequence
          Length = 199288

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    gtaaaagcaacaaacatagc 153
              ||||||||||||||||||||
Sbjct: 148821 gtaaaagcaacaaacatagc 148840



to top

>dbj|AK090011.1| Mus musculus RCB-0464 Meth-A cDNA, RIKEN full-length enriched
            library, clone:G430059M05 product:RIKEN cDNA 2010110K24
            gene, full insert sequence
          Length = 1597

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 130  aaaggtaaaagcaacaaaca 149
            ||||||||||||||||||||
Sbjct: 1467 aaaggtaaaagcaacaaaca 1448



to top

>gb|AC007256.5| Homo sapiens BAC clone RP11-575C6 from 2, complete sequence
          Length = 181150

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     gcaaccactttcagttttta 54
              ||||||||||||||||||||
Sbjct: 135952 gcaaccactttcagttttta 135971



to top

>gb|AC148019.5| Mus musculus BAC clone RP23-12B6 from chromosome 18, complete sequence
          Length = 211149

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    ctaatttctgtccaaagtca 225
              ||||||||||||||||||||
Sbjct: 127159 ctaatttctgtccaaagtca 127140



to top

>emb|AL954339.10| Zebrafish DNA sequence from clone CH211-221J21 in linkage group 12,
              complete sequence
          Length = 203958

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 266    taggtggggcaatggcacca 285
              ||||||||||||||||||||
Sbjct: 152628 taggtggggcaatggcacca 152609



to top

>gb|DQ355026.1| Homo sapiens caspase 8, apoptosis-related cysteine peptidase (CASP8)
             gene, complete cds
          Length = 57727

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    gcaaccactttcagttttta 54
             ||||||||||||||||||||
Sbjct: 49537 gcaaccactttcagttttta 49518



to top

>emb|AL117192.5|CNS01DRE Human chromosome 14 DNA sequence BAC R-862G15 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 210869

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 267    aggtggggcaatggcaccaa 286
              ||||||||||||||||||||
Sbjct: 174610 aggtggggcaatggcaccaa 174629



to top

>gb|AC154200.1| Mus musculus BAC clone RP24-81G10 from 17, complete sequence
          Length = 216721

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 130    aaaggtaaaagcaacaaaca 149
              ||||||||||||||||||||
Sbjct: 122665 aaaggtaaaagcaacaaaca 122646



to top

>gb|AC102056.17| Mus musculus chromosome 5, clone RP23-190H2, complete sequence
          Length = 184495

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   gaaaaggtaaaagcaacaaa 147
             ||||||||||||||||||||
Sbjct: 37005 gaaaaggtaaaagcaacaaa 36986


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,905,025
Number of Sequences: 3902068
Number of extensions: 2905025
Number of successful extensions: 49743
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49717
Number of HSP's gapped (non-prelim): 26
length of query: 355
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 333
effective length of database: 17,147,199,772
effective search space: 5710017524076
effective search space used: 5710017524076
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top