ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl46f07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC127434.1| Mus musculus BAC clone RP23-189J11 from 19, compl... 38 1.5
2emb|AL513170.16| Human DNA sequence from clone RP11-285B4 on chr... 38 1.5
3emb|AL137008.9| Human DNA sequence from clone RP3-361I14 on chro... 38 1.5
4dbj|AK056797.1| Homo sapiens cDNA FLJ32235 fis, clone PLACE6004738 38 1.5
5ref|XM_361801.1| Magnaporthe grisea 70-15 hypothetical protein (... 36 5.7
6gb|AC130214.4| Mus musculus BAC clone RP23-245B21 from chromosom... 36 5.7
7ref|XM_642834.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 36 5.7
8ref|XM_645017.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 36 5.7
9ref|XM_646626.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 36 5.7
10emb|CR391949.7| Zebrafish DNA sequence from clone CH211-149B20 i... 36 5.7
11emb|AL356135.11| Human DNA sequence from clone RP11-396K16 on ch... 36 5.7
12emb|AL662802.14| Mouse DNA sequence from clone RP23-34N10 on chr... 36 5.7
13gb|AC022821.9| Homo sapiens chromosome 8, clone RP11-51M18, comp... 36 5.7
14gb|AC016879.6| Homo sapiens chromosome 8, clone RP11-97P19, comp... 36 5.7
15gb|AC153132.4| Mus musculus BAC clone RP24-362N19 from chromosom... 36 5.7
16emb|BX571667.5| Zebrafish DNA sequence from clone DKEY-267K7 in ... 36 5.7
17gb|AC092632.2| Homo sapiens BAC clone RP11-337B18 from 2, comple... 36 5.7
18gb|AC140445.3| Mus musculus BAC clone RP23-61D2 from 13, complet... 36 5.7

>gb|AC127434.1| Mus musculus BAC clone RP23-189J11 from 19, complete sequence
          Length = 199422

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 16     aggattattgcatgtacta 34
              |||||||||||||||||||
Sbjct: 129086 aggattattgcatgtacta 129068



to top

>emb|AL513170.16| Human DNA sequence from clone RP11-285B4 on chromosome 1, complete
             sequence
          Length = 96748

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 20    ttattgcatgtactattgaggtc 42
             |||||||||||||| ||||||||
Sbjct: 29250 ttattgcatgtacttttgaggtc 29272



to top

>emb|AL137008.9| Human DNA sequence from clone RP3-361I14 on chromosome 6 Contains a
             KIAA1470 pseudogene and the 3' end of the BPAG1 gene for
             bullous pemphigoid antigen 1 (230/240kD), complete
             sequence
          Length = 67033

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 23    ttgcatgtactattgaggt 41
             |||||||||||||||||||
Sbjct: 33211 ttgcatgtactattgaggt 33229



to top

>dbj|AK056797.1| Homo sapiens cDNA FLJ32235 fis, clone PLACE6004738
          Length = 2016

 Score = 38.2 bits (19), Expect = 1.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 23  ttgcatgtactattgaggt 41
           |||||||||||||||||||
Sbjct: 149 ttgcatgtactattgaggt 131



to top

>ref|XM_361801.1| Magnaporthe grisea 70-15 hypothetical protein (MG04275.4) partial
            mRNA
          Length = 2490

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 6    attccatttcaggattat 23
            ||||||||||||||||||
Sbjct: 1284 attccatttcaggattat 1301



to top

>gb|AC130214.4| Mus musculus BAC clone RP23-245B21 from chromosome 16, complete
             sequence
          Length = 216170

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 8     tccatttcaggattattg 25
             ||||||||||||||||||
Sbjct: 78734 tccatttcaggattattg 78717



to top

>ref|XM_642834.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (782.t00002)
           partial mRNA
          Length = 942

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 7   ttccatttcaggattatt 24
           ||||||||||||||||||
Sbjct: 501 ttccatttcaggattatt 484



to top

>ref|XM_645017.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (246.t00007)
           partial mRNA
          Length = 942

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 7   ttccatttcaggattatt 24
           ||||||||||||||||||
Sbjct: 501 ttccatttcaggattatt 484



to top

>ref|XM_646626.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (151.t00022)
           partial mRNA
          Length = 942

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 7   ttccatttcaggattatt 24
           ||||||||||||||||||
Sbjct: 501 ttccatttcaggattatt 484



to top

>emb|CR391949.7| Zebrafish DNA sequence from clone CH211-149B20 in linkage group 9,
             complete sequence
          Length = 162252

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    catttcaggattattgca 27
             ||||||||||||||||||
Sbjct: 88592 catttcaggattattgca 88609



to top

>emb|AL356135.11| Human DNA sequence from clone RP11-396K16 on chromosome 6, complete
            sequence
          Length = 68827

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 5    cattccatttcaggatta 22
            ||||||||||||||||||
Sbjct: 5183 cattccatttcaggatta 5200



to top

>emb|AL662802.14| Mouse DNA sequence from clone RP23-34N10 on chromosome 11, complete
              sequence
          Length = 224024

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     catttcaggattattgca 27
              ||||||||||||||||||
Sbjct: 158632 catttcaggattattgca 158649



to top

>gb|AC022821.9| Homo sapiens chromosome 8, clone RP11-51M18, complete sequence
          Length = 171721

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    ttcaggattattgcatgt 30
             ||||||||||||||||||
Sbjct: 67914 ttcaggattattgcatgt 67897



to top

>gb|AC016879.6| Homo sapiens chromosome 8, clone RP11-97P19, complete sequence
          Length = 182556

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    ttcaggattattgcatgt 30
             ||||||||||||||||||
Sbjct: 21561 ttcaggattattgcatgt 21578



to top

>gb|AC153132.4| Mus musculus BAC clone RP24-362N19 from chromosome 13, complete sequence
          Length = 178970

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 7      ttccatttcaggattatt 24
              ||||||||||||||||||
Sbjct: 106265 ttccatttcaggattatt 106282



to top

>emb|BX571667.5| Zebrafish DNA sequence from clone DKEY-267K7 in linkage group 1,
             complete sequence
          Length = 151582

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 21    tattgcatgtactattga 38
             ||||||||||||||||||
Sbjct: 34366 tattgcatgtactattga 34383



to top

>gb|AC092632.2| Homo sapiens BAC clone RP11-337B18 from 2, complete sequence
          Length = 199385

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 9      ccatttcaggattattgcatgt 30
              |||| |||||||||||||||||
Sbjct: 133678 ccatatcaggattattgcatgt 133657



to top

>gb|AC140445.3| Mus musculus BAC clone RP23-61D2 from 13, complete sequence
          Length = 127017

 Score = 36.2 bits (18), Expect = 5.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     ttccatttcaggattatt 24
             ||||||||||||||||||
Sbjct: 11031 ttccatttcaggattatt 11014


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 314,695
Number of Sequences: 3902068
Number of extensions: 314695
Number of successful extensions: 81749
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81719
Number of HSP's gapped (non-prelim): 30
length of query: 46
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 26
effective length of database: 17,155,003,908
effective search space: 446030101608
effective search space used: 446030101608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top