ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl46e11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 38 0.78
2gb|AC124535.4| Mus musculus BAC clone RP23-331C24 from chromosom... 38 0.78
3gb|AC165311.3| Mus musculus chromosome 18, clone RP23-352F3, com... 38 0.78
4gb|AC093521.3| Homo sapiens chromosome 5 clone RP11-152P24, comp... 38 0.78
5ref|XM_523972.1| PREDICTED: Pan troglodytes similar to zinc fing... 36 3.1
6ref|NM_006540.2| Homo sapiens nuclear receptor coactivator 2 (NC... 36 3.1
7gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome 36 3.1
8gb|AC084251.13| Homo sapiens chromosome 8, clone RP11-152C15, co... 36 3.1
9emb|AL117329.8|HSBA191L9 Human DNA sequence from clone RP11-191L... 36 3.1
10emb|AJ630363.1| Canis familiaris MHC class II region on chromoso... 36 3.1
11gb|AC091589.8| Homo sapiens chromosome 18, clone RP11-635B11, co... 36 3.1
12dbj|AK056288.1| Homo sapiens cDNA FLJ31726 fis, clone NT2RI20067... 36 3.1
13gb|AC000040.4| Homo sapiens Chromosome 22q13 Cosmid Clone p130c1... 36 3.1
14gb|AC138660.4| Homo sapiens chromosome 18, clone XXfos-80851B11,... 36 3.1
15emb|AL929018.14| Mouse DNA sequence from clone RP23-253K17 on ch... 36 3.1
16emb|AJ132000.1|CPL132000 Craterostigma plantagineum mRNA sucrose... 36 3.1
17emb|BX640464.10| Zebrafish DNA sequence from clone DKEY-22M8 in ... 36 3.1
18emb|AL627123.13| Mouse DNA sequence from clone RP23-351I23 on ch... 36 3.1
19emb|X97674.1|HSTIF2GEN H.sapiens mRNA for transcriptional interm... 36 3.1

>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
              SNF2P genes, complete cds; nucellin pseudogene, complete
              sequence; putative transposase, phosphatidylinositol
              phosphatidylcholine transfer protein sec14 cytosolic-like
              protein, and phytochrome P450-like protein genes, complete
              cds; and unknown genes
          Length = 438828

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 1      aataaacatgcttccaaaa 19
              |||||||||||||||||||
Sbjct: 390150 aataaacatgcttccaaaa 390132



to top

>gb|AC124535.4| Mus musculus BAC clone RP23-331C24 from chromosome 18, complete sequence
          Length = 206191

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      acatgcttccaaaacctgg 24
              |||||||||||||||||||
Sbjct: 116577 acatgcttccaaaacctgg 116595



to top

>gb|AC165311.3| Mus musculus chromosome 18, clone RP23-352F3, complete sequence
          Length = 174474

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      acatgcttccaaaacctgg 24
              |||||||||||||||||||
Sbjct: 145054 acatgcttccaaaacctgg 145072



to top

>gb|AC093521.3| Homo sapiens chromosome 5 clone RP11-152P24, complete sequence
          Length = 143970

 Score = 38.2 bits (19), Expect = 0.78
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     tgcttccaaaacctggcag 27
             |||||||||||||||||||
Sbjct: 58066 tgcttccaaaacctggcag 58048



to top

>ref|XM_523972.1| PREDICTED: Pan troglodytes similar to zinc finger protein 407
           (LOC468583), mRNA
          Length = 5541

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 1   aataaacatgcttccaaa 18
           ||||||||||||||||||
Sbjct: 205 aataaacatgcttccaaa 222



to top

>ref|NM_006540.2| Homo sapiens nuclear receptor coactivator 2 (NCOA2), mRNA
          Length = 6157

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1    aataaacatgcttccaaa 18
            ||||||||||||||||||
Sbjct: 5627 aataaacatgcttccaaa 5610



to top

>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome
          Length = 1545895

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 2       ataaacatgcttccaaaa 19
               ||||||||||||||||||
Sbjct: 1255475 ataaacatgcttccaaaa 1255492



to top

>gb|AC084251.13| Homo sapiens chromosome 8, clone RP11-152C15, complete sequence
          Length = 181400

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      aataaacatgcttccaaa 18
              ||||||||||||||||||
Sbjct: 143087 aataaacatgcttccaaa 143104



to top

>emb|AL117329.8|HSBA191L9 Human DNA sequence from clone RP11-191L9 on chromosome 22, complete
              sequence
          Length = 146438

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 2      ataaacatgcttccaaaacctg 23
              ||||||||| ||||||||||||
Sbjct: 130368 ataaacatgtttccaaaacctg 130389



to top

>emb|AJ630363.1| Canis familiaris MHC class II region on chromosome CFA12, partial
              sequence, BAC clones 224p2 and 282j14, containing DLA-DQA1
              gene, DLA-DQB1 gene and DLA-DQB pseudogene
          Length = 180560

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      aataaacatgcttccaaa 18
              ||||||||||||||||||
Sbjct: 133618 aataaacatgcttccaaa 133635



to top

>gb|AC091589.8| Homo sapiens chromosome 18, clone RP11-635B11, complete sequence
          Length = 177680

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1    aataaacatgcttccaaa 18
            ||||||||||||||||||
Sbjct: 6918 aataaacatgcttccaaa 6935



to top

>dbj|AK056288.1| Homo sapiens cDNA FLJ31726 fis, clone NT2RI2006735, weakly similar
           to Neofelis nebulosa strain nnex zinc finger protein Zfx
           gene
          Length = 2451

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 1   aataaacatgcttccaaa 18
           ||||||||||||||||||
Sbjct: 304 aataaacatgcttccaaa 321



to top

>gb|AC000040.4| Homo sapiens Chromosome 22q13 Cosmid Clone p130c12, complete sequence
          Length = 38134

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 2     ataaacatgcttccaaaacctg 23
             ||||||||| ||||||||||||
Sbjct: 28428 ataaacatgtttccaaaacctg 28449



to top

>gb|AC138660.4| Homo sapiens chromosome 18, clone XXfos-80851B11, complete sequence
          Length = 37580

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     aataaacatgcttccaaa 18
             ||||||||||||||||||
Sbjct: 27746 aataaacatgcttccaaa 27729



to top

>emb|AL929018.14| Mouse DNA sequence from clone RP23-253K17 on chromosome 2, complete
             sequence
          Length = 189343

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    aaacctggcaggtcatga 34
             ||||||||||||||||||
Sbjct: 71310 aaacctggcaggtcatga 71293



to top

>emb|AJ132000.1|CPL132000 Craterostigma plantagineum mRNA sucrose synthase 2
          Length = 2648

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 4    aaacatgcttccaaaacc 21
            ||||||||||||||||||
Sbjct: 2370 aaacatgcttccaaaacc 2353



to top

>emb|BX640464.10| Zebrafish DNA sequence from clone DKEY-22M8 in linkage group 19, complete
              sequence
          Length = 255824

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      aataaacatgcttccaaa 18
              ||||||||||||||||||
Sbjct: 147392 aataaacatgcttccaaa 147375



to top

>emb|AL627123.13| Mouse DNA sequence from clone RP23-351I23 on chromosome 4, complete
             sequence
          Length = 185022

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    cttccaaaacctggcagg 28
             ||||||||||||||||||
Sbjct: 79192 cttccaaaacctggcagg 79209



to top

>emb|X97674.1|HSTIF2GEN H.sapiens mRNA for transcriptional intermediary factor 2
          Length = 6156

 Score = 36.2 bits (18), Expect = 3.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1    aataaacatgcttccaaa 18
            ||||||||||||||||||
Sbjct: 5627 aataaacatgcttccaaa 5610


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 256,614
Number of Sequences: 3902068
Number of extensions: 256614
Number of successful extensions: 74819
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74771
Number of HSP's gapped (non-prelim): 48
length of query: 34
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 14
effective length of database: 17,155,003,908
effective search space: 240170054712
effective search space used: 240170054712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top