ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl46b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_667831.1| Plasmodium berghei strain ANKA hypothetical pro... 44 0.24
2gb|AY702775.1| Uncultured fungus from ectomycorrhizal root isola... 44 0.24
3emb|AL137140.12| Human DNA sequence from clone RP11-137M6 on chr... 42 0.96
4gb|AC117783.9| Mus musculus chromosome 16, clone RP24-544H3, com... 40 3.8
5gb|AC117686.10| Mus musculus chromosome 16, clone RP23-440B15, c... 40 3.8
6ref|XM_725012.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 3.8
7emb|AL353638.15| Human DNA sequence from clone RP11-338L20 on ch... 40 3.8
8gb|AY098460.1| Drosophila fuyamai strain CM771 cytochrome oxidas... 40 3.8
9emb|BX537139.17| Zebrafish DNA sequence from clone DKEY-46K9 in ... 40 3.8
10gb|BC086991.1| Rattus norvegicus guanylate nucleotide binding pr... 40 3.8
11ref|NM_133624.1| Rattus norvegicus guanylate nucleotide binding ... 40 3.8
12gb|AY174098.1|AY174098S1 Drosophila melanogaster Na/K ATPase alp... 40 3.8
13gb|AC009348.6|AC009348 Drosophila melanogaster, chromosome 3R, r... 40 3.8
14gb|AC154497.2| Mus musculus BAC clone RP24-112C15 from chromosom... 40 3.8
15gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 3.8
16gb|AC154378.2| Mus musculus BAC clone RP23-64O5 from 17, complet... 40 3.8
17gb|AE003732.3| Drosophila melanogaster chromosome 3R, section 70... 40 3.8
18gb|M80367.1|RATUIP Rat isoprenylated 67 kDa protein mRNA, comple... 40 3.8

>ref|XM_667831.1| Plasmodium berghei strain ANKA hypothetical protein (PB000718.03.0)
           partial mRNA
          Length = 1131

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 166 tagtatgattgtattgtcttca 187
           ||||||||||||||||||||||
Sbjct: 354 tagtatgattgtattgtcttca 333



to top

>gb|AY702775.1| Uncultured fungus from ectomycorrhizal root isolate TK1784A 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 980

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 67  cggtttacagcgttacaagaca 88
           ||||||||||||||||||||||
Sbjct: 592 cggtttacagcgttacaagaca 571



to top

>emb|AL137140.12| Human DNA sequence from clone RP11-137M6 on chromosome 13q21.33-22.3
              Contains the SCEL gene for sciellin, a novel gene and a CpG
              island, complete sequence
          Length = 193098

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 226    gaaataaacatgcttctctgc 246
              |||||||||||||||||||||
Sbjct: 125555 gaaataaacatgcttctctgc 125575



to top

>gb|AC117783.9| Mus musculus chromosome 16, clone RP24-544H3, complete sequence
          Length = 164296

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 30    cataatcatgccacagcacacata 53
             |||| |||||||||||||||||||
Sbjct: 77240 catactcatgccacagcacacata 77217



to top

>gb|AC117686.10| Mus musculus chromosome 16, clone RP23-440B15, complete sequence
          Length = 210851

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 30     cataatcatgccacagcacacata 53
              |||| |||||||||||||||||||
Sbjct: 196103 catactcatgccacagcacacata 196080



to top

>ref|XM_725012.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY02235)
           partial mRNA
          Length = 1431

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 168 gtatgattgtattgtcttca 187
           ||||||||||||||||||||
Sbjct: 607 gtatgattgtattgtcttca 588



to top

>emb|AL353638.15| Human DNA sequence from clone RP11-338L20 on chromosome 9 Contains a
              ribosomal protein S26 pseudogene 3 and part the 5' UTR of
              the PTPRD gene for protein tyrosine phosphatase, receptor
              type, D (HPTP, PTPD, HPTPD), complete sequence
          Length = 161067

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 198    cttgatttcacatattatca 217
              ||||||||||||||||||||
Sbjct: 154908 cttgatttcacatattatca 154889



to top

>gb|AY098460.1| Drosophila fuyamai strain CM771 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 407

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 202 atttcacatattatcagcca 221
           ||||||||||||||||||||
Sbjct: 23  atttcacatattatcagcca 42



to top

>emb|BX537139.17| Zebrafish DNA sequence from clone DKEY-46K9 in linkage group 9, complete
              sequence
          Length = 243063

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 116    ggctggccatcataaccaaa 135
              ||||||||||||||||||||
Sbjct: 198254 ggctggccatcataaccaaa 198273



to top

>gb|BC086991.1| Rattus norvegicus guanylate nucleotide binding protein 2, mRNA
           (cDNA clone MGC:93208 IMAGE:7191761), complete cds
          Length = 2383

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 97  acagagttttgacagcagag 116
           ||||||||||||||||||||
Sbjct: 980 acagagttttgacagcagag 961



to top

>ref|NM_133624.1| Rattus norvegicus guanylate nucleotide binding protein 2 (Gbp2), mRNA
          Length = 2396

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   acagagttttgacagcagag 116
            ||||||||||||||||||||
Sbjct: 1019 acagagttttgacagcagag 1000



to top

>gb|AY174098.1|AY174098S1 Drosophila melanogaster Na/K ATPase alpha subunit (Atpalpha) gene,
            exons 10, 14, 15, 1, and partial cds, alternatively
            spliced
          Length = 4535

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 127  ataaccaaatatacatgataaata 150
            ||||||||||||| ||||||||||
Sbjct: 3956 ataaccaaatatatatgataaata 3933



to top

>gb|AC009348.6|AC009348 Drosophila melanogaster, chromosome 3R, region 93A-93B, BAC clone
             BACR05I01, complete sequence
          Length = 187151

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 127   ataaccaaatatacatgataaata 150
             ||||||||||||| ||||||||||
Sbjct: 59678 ataaccaaatatatatgataaata 59655



to top

>gb|AC154497.2| Mus musculus BAC clone RP24-112C15 from chromosome 17, complete sequence
          Length = 176161

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 210    tattatcagccacggcgaaataaacatg 237
              ||||||||| || |||||||||||||||
Sbjct: 163186 tattatcagacaaggcgaaataaacatg 163213



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 247     cacgtcgctcgcccggtcgc 266
               ||||||||||||||||||||
Sbjct: 4685626 cacgtcgctcgcccggtcgc 4685645



to top

>gb|AC154378.2| Mus musculus BAC clone RP23-64O5 from 17, complete sequence
          Length = 232701

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    gccacagcacacatagtaca 58
             ||||||||||||||||||||
Sbjct: 69565 gccacagcacacatagtaca 69584



to top

>gb|AE003732.3| Drosophila melanogaster chromosome 3R, section 70 of 118 of the complete
              sequence
          Length = 224529

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 127    ataaccaaatatacatgataaata 150
              ||||||||||||| ||||||||||
Sbjct: 208010 ataaccaaatatatatgataaata 207987



to top

>gb|M80367.1|RATUIP Rat isoprenylated 67 kDa protein mRNA, complete cds
          Length = 2396

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   acagagttttgacagcagag 116
            ||||||||||||||||||||
Sbjct: 1019 acagagttttgacagcagag 1000


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,443,511
Number of Sequences: 3902068
Number of extensions: 2443511
Number of successful extensions: 53903
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53868
Number of HSP's gapped (non-prelim): 35
length of query: 291
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 269
effective length of database: 17,147,199,772
effective search space: 4612596738668
effective search space used: 4612596738668
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top