ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl45f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 161 2e-36
2gb|AC125496.3| Oryza sativa (japonica cultivar-group) chromosome... 161 2e-36
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 161 2e-36
4dbj|AK068503.1| Oryza sativa (japonica cultivar-group) cDNA clon... 161 2e-36
5gb|AC106716.3| Homo sapiens 3 BAC RP11-202P1 (Roswell Park Cance... 44 0.39
6gb|AC117424.6| Homo sapiens 3 BAC RP11-172I10 (Roswell Park Canc... 44 0.39
7gb|AC183622.3| Pan troglodytes BAC clone CH251-66G8 from chromos... 42 1.5
8emb|BX548161.12| Zebrafish DNA sequence from clone DKEY-248F6 in... 42 1.5
9gb|AC087474.9| Homo sapiens chromosome 15, clone RP11-350A1, com... 42 1.5
10emb|BX000364.6| Zebrafish DNA sequence from clone DKEY-11K1 in l... 42 1.5
11gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete ge... 42 1.5
12gb|AC117621.7| Mus musculus chromosome 8, clone RP23-114B10, com... 40 6.0
13gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, comp... 40 6.0
14gb|AC162389.6| Mus musculus 6 BAC RP24-114M8 (Roswell Park Cance... 40 6.0
15ref|XM_388668.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 40 6.0
16emb|CR388017.7| Zebrafish DNA sequence from clone CH211-283H24 i... 40 6.0
17gb|AC115123.4| Mus musculus BAC clone RP24-129O20 from 3, comple... 40 6.0
18gb|AC121925.2| Mus musculus BAC clone RP24-201D17 from 6, comple... 40 6.0
19ref|XM_774519.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 6.0
20gb|AC114995.7| Mus musculus chromosome 8, clone RP23-171P5, comp... 40 6.0
21gb|AC136712.9| Mus musculus chromosome 3, clone RP23-36H15, comp... 40 6.0
22gb|AC148607.16| Medicago truncatula clone mth2-43g15, complete s... 40 6.0
23emb|AL353807.18| Human DNA sequence from clone RP11-29H23 on chr... 40 6.0
24emb|BX511084.9| Zebrafish DNA sequence from clone DKEY-265C15 in... 40 6.0
25emb|CR381585.11| Zebrafish DNA sequence from clone DKEY-27P7 in ... 40 6.0
26gb|AC083837.4| Homo sapiens chromosome 8, clone RP11-79H23, comp... 40 6.0
27gb|AC148986.5| Mus musculus BAC clone RP23-89A16 from chromosome... 40 6.0
28gb|AC159625.2| Mus musculus BAC clone RP24-262L7 from chromosome... 40 6.0
29dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 40 6.0
30gb|AC154185.1| Mus musculus BAC clone RP24-67L15 from chromosome... 40 6.0
31emb|BX001022.9| Zebrafish DNA sequence from clone CH211-243O19, ... 40 6.0
32gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, com... 40 6.0
33dbj|AP001829.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.0
34gb|AC161242.2| Mus musculus BAC clone RP24-200E4 from chromosome... 40 6.0
35gb|AC141883.4| Mus musculus BAC clone RP24-128P19 from 7, comple... 40 6.0

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  161 bits (81), Expect = 2e-36
 Identities = 171/201 (85%)
 Strand = Plus / Minus

                                                                            
Query: 243      tccctcagcagaggtttggataaaattgggacgaaaccttcaaggattcaacatcatcaa 302
                |||||||||||||| | | ||||||||| || ||    ||||||||||  ||||||||||
Sbjct: 12443028 tccctcagcagaggctcgaataaaattgagatgattttttcaaggatttgacatcatcaa 12442969

                                                                            
Query: 303      ttgcagtccatgactgctcttgcagcttggcagcctcagcaatatcagagttgcaaccat 362
                ||| | |||||||||||||||  |||||||||||||||||||| || |||||||| ||||
Sbjct: 12442968 ttgtaatccatgactgctcttttagcttggcagcctcagcaatgtctgagttgcagccat 12442909

                                                                            
Query: 363      acacatggattgccaatcgtctacgtgttggagaagatgatcttatgtaggtattgtacc 422
                ||||||||||||| |||||||| ||  | ||||| |||| | | ||||| ||||||||||
Sbjct: 12442908 acacatggattgctaatcgtctgcgcttgggagatgatggtttaatgtaagtattgtacc 12442849

                                     
Query: 423      aactgatgacgtcctccttcc 443
                ||||||| || ||||||||||
Sbjct: 12442848 aactgattacatcctccttcc 12442828



to top

>gb|AC125496.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0098H14,
              complete sequence
          Length = 132560

 Score =  161 bits (81), Expect = 2e-36
 Identities = 171/201 (85%)
 Strand = Plus / Minus

                                                                          
Query: 243    tccctcagcagaggtttggataaaattgggacgaaaccttcaaggattcaacatcatcaa 302
              |||||||||||||| | | ||||||||| || ||    ||||||||||  ||||||||||
Sbjct: 100710 tccctcagcagaggctcgaataaaattgagatgattttttcaaggatttgacatcatcaa 100651

                                                                          
Query: 303    ttgcagtccatgactgctcttgcagcttggcagcctcagcaatatcagagttgcaaccat 362
              ||| | |||||||||||||||  |||||||||||||||||||| || |||||||| ||||
Sbjct: 100650 ttgtaatccatgactgctcttttagcttggcagcctcagcaatgtctgagttgcagccat 100591

                                                                          
Query: 363    acacatggattgccaatcgtctacgtgttggagaagatgatcttatgtaggtattgtacc 422
              ||||||||||||| |||||||| ||  | ||||| |||| | | ||||| ||||||||||
Sbjct: 100590 acacatggattgctaatcgtctgcgcttgggagatgatggtttaatgtaagtattgtacc 100531

                                   
Query: 423    aactgatgacgtcctccttcc 443
              ||||||| || ||||||||||
Sbjct: 100530 aactgattacatcctccttcc 100510



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  161 bits (81), Expect = 2e-36
 Identities = 171/201 (85%)
 Strand = Plus / Minus

                                                                            
Query: 243      tccctcagcagaggtttggataaaattgggacgaaaccttcaaggattcaacatcatcaa 302
                |||||||||||||| | | ||||||||| || ||    ||||||||||  ||||||||||
Sbjct: 12439791 tccctcagcagaggctcgaataaaattgagatgattttttcaaggatttgacatcatcaa 12439732

                                                                            
Query: 303      ttgcagtccatgactgctcttgcagcttggcagcctcagcaatatcagagttgcaaccat 362
                ||| | |||||||||||||||  |||||||||||||||||||| || |||||||| ||||
Sbjct: 12439731 ttgtaatccatgactgctcttttagcttggcagcctcagcaatgtctgagttgcagccat 12439672

                                                                            
Query: 363      acacatggattgccaatcgtctacgtgttggagaagatgatcttatgtaggtattgtacc 422
                ||||||||||||| |||||||| ||  | ||||| |||| | | ||||| ||||||||||
Sbjct: 12439671 acacatggattgctaatcgtctgcgcttgggagatgatggtttaatgtaagtattgtacc 12439612

                                     
Query: 423      aactgatgacgtcctccttcc 443
                ||||||| || ||||||||||
Sbjct: 12439611 aactgattacatcctccttcc 12439591



to top

>dbj|AK068503.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013153C08, full
            insert sequence
          Length = 3677

 Score =  161 bits (81), Expect = 2e-36
 Identities = 171/201 (85%)
 Strand = Plus / Minus

                                                                        
Query: 243  tccctcagcagaggtttggataaaattgggacgaaaccttcaaggattcaacatcatcaa 302
            |||||||||||||| | | ||||||||| || ||    ||||||||||  ||||||||||
Sbjct: 3226 tccctcagcagaggctcgaataaaattgagatgattttttcaaggatttgacatcatcaa 3167

                                                                        
Query: 303  ttgcagtccatgactgctcttgcagcttggcagcctcagcaatatcagagttgcaaccat 362
            ||| | |||||||||||||||  |||||||||||||||||||| || |||||||| ||||
Sbjct: 3166 ttgtaatccatgactgctcttttagcttggcagcctcagcaatgtctgagttgcagccat 3107

                                                                        
Query: 363  acacatggattgccaatcgtctacgtgttggagaagatgatcttatgtaggtattgtacc 422
            ||||||||||||| |||||||| ||  | ||||| |||| | | ||||| ||||||||||
Sbjct: 3106 acacatggattgctaatcgtctgcgcttgggagatgatggtttaatgtaagtattgtacc 3047

                                 
Query: 423  aactgatgacgtcctccttcc 443
            ||||||| || ||||||||||
Sbjct: 3046 aactgattacatcctccttcc 3026



to top

>gb|AC106716.3| Homo sapiens 3 BAC RP11-202P1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 152883

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 110    tttctgtagataattgttttat 131
              ||||||||||||||||||||||
Sbjct: 152165 tttctgtagataattgttttat 152144



to top

>gb|AC117424.6| Homo sapiens 3 BAC RP11-172I10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 136511

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 110   tttctgtagataattgttttat 131
             ||||||||||||||||||||||
Sbjct: 50503 tttctgtagataattgttttat 50524



to top

>gb|AC183622.3| Pan troglodytes BAC clone CH251-66G8 from chromosome 15, complete
              sequence
          Length = 206618

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 105    atgattttctgtagataattgttttatat 133
              |||||| | ||||||||||||||||||||
Sbjct: 163021 atgattatatgtagataattgttttatat 162993



to top

>emb|BX548161.12| Zebrafish DNA sequence from clone DKEY-248F6 in linkage group 16,
             complete sequence
          Length = 188754

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 110   tttctgtagataattgtttta 130
             |||||||||||||||||||||
Sbjct: 65723 tttctgtagataattgtttta 65703



to top

>gb|AC087474.9| Homo sapiens chromosome 15, clone RP11-350A1, complete sequence
          Length = 185221

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 105    atgattttctgtagataattgttttatat 133
              |||||| | ||||||||||||||||||||
Sbjct: 137710 atgattatatgtagataattgttttatat 137682



to top

>emb|BX000364.6| Zebrafish DNA sequence from clone DKEY-11K1 in linkage group 17,
             complete sequence
          Length = 189563

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 108   attttctgtagataattgttt 128
             |||||||||||||||||||||
Sbjct: 74367 attttctgtagataattgttt 74347



to top

>gb|CP000023.1| Streptococcus thermophilus LMG 18311, complete genome
          Length = 1796846

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 284     aaggattcaacatcatcaatt 304
               |||||||||||||||||||||
Sbjct: 1299378 aaggattcaacatcatcaatt 1299398



to top

>gb|AC117621.7| Mus musculus chromosome 8, clone RP23-114B10, complete sequence
          Length = 214933

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 151    gtccaaactgcagccacaca 170
              ||||||||||||||||||||
Sbjct: 168021 gtccaaactgcagccacaca 168040



to top

>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence
          Length = 189304

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 82   cttggtggaggcagccacac 101
            ||||||||||||||||||||
Sbjct: 4717 cttggtggaggcagccacac 4736



to top

>gb|AC162389.6| Mus musculus 6 BAC RP24-114M8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 189477

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 324    gcagcttggcagcctcagca 343
              ||||||||||||||||||||
Sbjct: 156401 gcagcttggcagcctcagca 156420



to top

>ref|XM_388668.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08492.1)
            partial mRNA
          Length = 1929

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 333  cagcctcagcaatatcagagttgcaacc 360
            ||||| |||||||||||||||| |||||
Sbjct: 1672 cagccacagcaatatcagagttacaacc 1699



to top

>emb|CR388017.7| Zebrafish DNA sequence from clone CH211-283H24 in linkage group 7,
             complete sequence
          Length = 111978

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   aactgcagccacacaaatga 175
             ||||||||||||||||||||
Sbjct: 37071 aactgcagccacacaaatga 37090



to top

>gb|AC115123.4| Mus musculus BAC clone RP24-129O20 from 3, complete sequence
          Length = 181380

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 108    attttctgtagataattgtt 127
              ||||||||||||||||||||
Sbjct: 181294 attttctgtagataattgtt 181313



to top

>gb|AC121925.2| Mus musculus BAC clone RP24-201D17 from 6, complete sequence
          Length = 180015

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 324   gcagcttggcagcctcagca 343
             ||||||||||||||||||||
Sbjct: 25423 gcagcttggcagcctcagca 25442



to top

>ref|XM_774519.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_81_139637_136254) partial mRNA
          Length = 3384

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 17  ttgtggaagattttctgtagatga 40
           ||||||||||||||||||| ||||
Sbjct: 368 ttgtggaagattttctgtacatga 391



to top

>gb|AC114995.7| Mus musculus chromosome 8, clone RP23-171P5, complete sequence
          Length = 242745

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   gtccaaactgcagccacaca 170
             ||||||||||||||||||||
Sbjct: 14850 gtccaaactgcagccacaca 14869



to top

>gb|AC136712.9| Mus musculus chromosome 3, clone RP23-36H15, complete sequence
          Length = 201139

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 108    attttctgtagataattgtt 127
              ||||||||||||||||||||
Sbjct: 102879 attttctgtagataattgtt 102898



to top

>gb|AC148607.16| Medicago truncatula clone mth2-43g15, complete sequence
          Length = 148291

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    acatgattttctgtagataa 122
              ||||||||||||||||||||
Sbjct: 106237 acatgattttctgtagataa 106256



to top

>emb|AL353807.18| Human DNA sequence from clone RP11-29H23 on chromosome 1 Contains the
             5' end of the ASH1L gene for ash1 (absent, small, or
             homeotic)-like (Drosophila), two novel genes, a pseudogene
             similar to part of death associated protein 3 (DAP3), the
             gene for a novel protein (FLJ10504), the 3' end of a novel
             pseudogene and a CpG island, complete sequence
          Length = 179064

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 109   ttttctgtagataattgttt 128
             ||||||||||||||||||||
Sbjct: 14233 ttttctgtagataattgttt 14214



to top

>emb|BX511084.9| Zebrafish DNA sequence from clone DKEY-265C15 in linkage group 13,
             complete sequence
          Length = 156524

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 221   accaaacaaacaggatccaa 240
             ||||||||||||||||||||
Sbjct: 52547 accaaacaaacaggatccaa 52528



to top

>emb|CR381585.11| Zebrafish DNA sequence from clone DKEY-27P7 in linkage group 20
             Contains the gene for a novel protein similar to mouse and
             human integrin beta 1 binding protein 1 (ITGB1BP1), the
             gene for a novel protein similar to vertebrate development
             and differentiation enhancing factor 2 (DDEF2) and three
             CpG islands, complete sequence
          Length = 209698

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   aactgcagccacacaaatga 175
             ||||||||||||||||||||
Sbjct: 80388 aactgcagccacacaaatga 80369



to top

>gb|AC083837.4| Homo sapiens chromosome 8, clone RP11-79H23, complete sequence
          Length = 166114

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   tcagcagaggtttggataaa 266
             ||||||||||||||||||||
Sbjct: 75482 tcagcagaggtttggataaa 75501



to top

>gb|AC148986.5| Mus musculus BAC clone RP23-89A16 from chromosome 7, complete sequence
          Length = 243039

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    cttggtggaggcagccacac 101
             ||||||||||||||||||||
Sbjct: 50019 cttggtggaggcagccacac 50000



to top

>gb|AC159625.2| Mus musculus BAC clone RP24-262L7 from chromosome 12, complete sequence
          Length = 189979

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 20     tggaagattttctgtagatg 39
              ||||||||||||||||||||
Sbjct: 177078 tggaagattttctgtagatg 177097



to top

>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 242     ttccctcagcagaggtttggataa 265
               |||||||| |||||||||||||||
Sbjct: 1183556 ttccctcatcagaggtttggataa 1183533



to top

>gb|AC154185.1| Mus musculus BAC clone RP24-67L15 from chromosome 17, complete sequence
          Length = 167726

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 305    gcagtccatgactgctcttg 324
              ||||||||||||||||||||
Sbjct: 124760 gcagtccatgactgctcttg 124741



to top

>emb|BX001022.9| Zebrafish DNA sequence from clone CH211-243O19, complete sequence
          Length = 160804

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 221   accaaacaaacaggatccaa 240
             ||||||||||||||||||||
Sbjct: 56882 accaaacaaacaggatccaa 56901



to top

>gb|AC102367.35| Mus musculus chromosome 3, clone RP23-211J6, complete sequence
          Length = 185452

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 97     cacacaacatgattttctgt 116
              ||||||||||||||||||||
Sbjct: 156276 cacacaacatgattttctgt 156257



to top

>dbj|AP001829.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-254C5, complete
             sequence
          Length = 117291

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 115   gtagataattgttttatatcaactatgg 142
             |||| ||||| |||||||||||||||||
Sbjct: 46483 gtaggtaattattttatatcaactatgg 46456



to top

>gb|AC161242.2| Mus musculus BAC clone RP24-200E4 from chromosome 12, complete sequence
          Length = 179665

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    tggaagattttctgtagatg 39
             ||||||||||||||||||||
Sbjct: 95063 tggaagattttctgtagatg 95082



to top

>gb|AC141883.4| Mus musculus BAC clone RP24-128P19 from 7, complete sequence
          Length = 189828

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 82     cttggtggaggcagccacac 101
              ||||||||||||||||||||
Sbjct: 102543 cttggtggaggcagccacac 102524


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,705,001
Number of Sequences: 3902068
Number of extensions: 4705001
Number of successful extensions: 96313
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 96167
Number of HSP's gapped (non-prelim): 142
length of query: 448
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 426
effective length of database: 17,147,199,772
effective search space: 7304707102872
effective search space used: 7304707102872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top