ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl45f02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome 48 0.025
2gb|AC073325.9| Homo sapiens BAC clone RP11-351I12 from 7, comple... 42 1.5
3gb|AC145090.1| Pan troglodytes BAC clone RP43-2G11 from 7, compl... 42 1.5
4gb|AC102488.11| Mus musculus chromosome 1, clone RP24-496O18, co... 42 1.5
5gb|AC147384.3| Pan troglodytes BAC clone RP43-158M15 from 7, com... 40 6.1
6gb|AC147386.3| Pan troglodytes BAC clone RP43-156E24 from 7, com... 40 6.1
7emb|CR854911.13| Zebrafish DNA sequence from clone DKEY-46O18 in... 40 6.1
8ref|XM_448822.1| Candida glabrata CBS138, CAGL0L01111g partial mRNA 40 6.1
9gb|AC142339.1| Pan troglodytes BAC clone RP43-42C16 from 7, comp... 40 6.1
10gb|AC134521.41| Medicago truncatula clone mth2-31k24, complete s... 40 6.1
11emb|AL357793.6| Human DNA sequence from clone RP11-98G13 on chro... 40 6.1
12emb|CR380958.1| Candida glabrata strain CBS138 chromosome L comp... 40 6.1
13emb|BX548053.7| Zebrafish DNA sequence from clone DKEY-189G17 in... 40 6.1
14gb|DQ397640.1| Cenarchaeum symbiosum clone C18F05, complete sequ... 40 6.1
15gb|DQ397620.1| Cenarchaeum symbiosum clone C07H12, complete sequ... 40 6.1
16gb|DQ397557.1| Cenarchaeum symbiosum clone C18C03, complete sequ... 40 6.1
17gb|AC098867.3| Homo sapiens BAC clone RP11-493C20 from 4, comple... 40 6.1
18gb|AC010389.8| Homo sapiens chromosome 5 clone CTD-2077I5, compl... 40 6.1
19gb|AC154504.2| Mus musculus BAC clone RP24-92H14 from chromosome... 40 6.1
20gb|AC048387.16| Homo sapiens chromosome 8, clone RP11-465K16, co... 40 6.1

>dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome
          Length = 1584804

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 125    agaaacctagattgagattcttca 148
              ||||||||||||||||||||||||
Sbjct: 378052 agaaacctagattgagattcttca 378029



to top

>gb|AC073325.9| Homo sapiens BAC clone RP11-351I12 from 7, complete sequence
          Length = 168872

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 264   gttttctgaaatttgcattca 284
             |||||||||||||||||||||
Sbjct: 83616 gttttctgaaatttgcattca 83636



to top

>gb|AC145090.1| Pan troglodytes BAC clone RP43-2G11 from 7, complete sequence
          Length = 173759

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 264   gttttctgaaatttgcattca 284
             |||||||||||||||||||||
Sbjct: 22923 gttttctgaaatttgcattca 22943



to top

>gb|AC102488.11| Mus musculus chromosome 1, clone RP24-496O18, complete sequence
          Length = 127076

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 264    gttttctgaaatttgcattca 284
              |||||||||||||||||||||
Sbjct: 102602 gttttctgaaatttgcattca 102582



to top

>gb|AC147384.3| Pan troglodytes BAC clone RP43-158M15 from 7, complete sequence
          Length = 212874

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     agtaaagctttggttctttc 25
             ||||||||||||||||||||
Sbjct: 64438 agtaaagctttggttctttc 64419



to top

>gb|AC147386.3| Pan troglodytes BAC clone RP43-156E24 from 7, complete sequence
          Length = 191925

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     agtaaagctttggttctttc 25
             ||||||||||||||||||||
Sbjct: 87471 agtaaagctttggttctttc 87452



to top

>emb|CR854911.13| Zebrafish DNA sequence from clone DKEY-46O18 in linkage group 9,
             complete sequence
          Length = 233574

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   aaatcaaaatgttctgtaaa 202
             ||||||||||||||||||||
Sbjct: 22256 aaatcaaaatgttctgtaaa 22275



to top

>ref|XM_448822.1| Candida glabrata CBS138, CAGL0L01111g partial mRNA
          Length = 1146

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 201  aacaatacaagaagggtgcattga 224
            |||||||||||||||||| |||||
Sbjct: 1013 aacaatacaagaagggtgaattga 1036



to top

>gb|AC142339.1| Pan troglodytes BAC clone RP43-42C16 from 7, complete sequence
          Length = 181207

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      agtaaagctttggttctttc 25
              ||||||||||||||||||||
Sbjct: 180930 agtaaagctttggttctttc 180911



to top

>gb|AC134521.41| Medicago truncatula clone mth2-31k24, complete sequence
          Length = 132267

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 78   tcaaatacattgaaatagaa 97
            ||||||||||||||||||||
Sbjct: 9837 tcaaatacattgaaatagaa 9818



to top

>emb|AL357793.6| Human DNA sequence from clone RP11-98G13 on chromosome 1 Contains a novel
              gene and part of a novel gene, complete sequence
          Length = 145630

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 185    atcaaaatgttctgtaaacaatac 208
              |||||||||||||| |||||||||
Sbjct: 137732 atcaaaatgttctgaaaacaatac 137709



to top

>emb|CR380958.1| Candida glabrata strain CBS138 chromosome L complete sequence
          Length = 1440588

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 201    aacaatacaagaagggtgcattga 224
              |||||||||||||||||| |||||
Sbjct: 132144 aacaatacaagaagggtgaattga 132167



to top

>emb|BX548053.7| Zebrafish DNA sequence from clone DKEY-189G17 in linkage group 9,
             complete sequence
          Length = 210830

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   aaatcaaaatgttctgtaaa 202
             ||||||||||||||||||||
Sbjct: 41048 aaatcaaaatgttctgtaaa 41029



to top

>gb|DQ397640.1| Cenarchaeum symbiosum clone C18F05, complete sequence
          Length = 39931

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   agcatcaggcgaggtcacag 377
             ||||||||||||||||||||
Sbjct: 33110 agcatcaggcgaggtcacag 33091



to top

>gb|DQ397620.1| Cenarchaeum symbiosum clone C07H12, complete sequence
          Length = 40229

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   agcatcaggcgaggtcacag 377
             ||||||||||||||||||||
Sbjct: 36221 agcatcaggcgaggtcacag 36202



to top

>gb|DQ397557.1| Cenarchaeum symbiosum clone C18C03, complete sequence
          Length = 38829

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 358  agcatcaggcgaggtcacag 377
            ||||||||||||||||||||
Sbjct: 6651 agcatcaggcgaggtcacag 6670



to top

>gb|AC098867.3| Homo sapiens BAC clone RP11-493C20 from 4, complete sequence
          Length = 142314

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 15    ttggttctttcttattaacataaa 38
             |||||||||| |||||||||||||
Sbjct: 94829 ttggttcttttttattaacataaa 94852



to top

>gb|AC010389.8| Homo sapiens chromosome 5 clone CTD-2077I5, complete sequence
          Length = 134060

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 67    ctgaattggtgtcaaatacattga 90
             ||||||| ||||||||||||||||
Sbjct: 89365 ctgaatttgtgtcaaatacattga 89388



to top

>gb|AC154504.2| Mus musculus BAC clone RP24-92H14 from chromosome 14, complete sequence
          Length = 234665

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 76     tgtcaaatacattgaaatagaagc 99
              ||||||||||||| ||||||||||
Sbjct: 137214 tgtcaaatacatttaaatagaagc 137237



to top

>gb|AC048387.16| Homo sapiens chromosome 8, clone RP11-465K16, complete sequence
          Length = 193896

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 87     ttgaaatagaagcaactatcatcaagaa 114
              ||||||||||||||||| |||| |||||
Sbjct: 103509 ttgaaatagaagcaactctcattaagaa 103482


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,008,901
Number of Sequences: 3902068
Number of extensions: 4008901
Number of successful extensions: 80374
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80330
Number of HSP's gapped (non-prelim): 44
length of query: 453
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 431
effective length of database: 17,147,199,772
effective search space: 7390443101732
effective search space used: 7390443101732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top