Clone Name | rbastl45f01 |
---|---|
Clone Library Name | barley_pub |
>gb|AC153508.2| Mus musculus 10 BAC RP23-233B6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190780 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 84473 agtttatgtatgatgagcata 84493
>ref|XM_990024.1| PREDICTED: Mus musculus RIKEN cDNA A230046K03 gene (A230046K03Rik), mRNA Length = 6027 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2834 agtttatgtatgatgagcata 2854
>ref|XM_987037.1| PREDICTED: Mus musculus RIKEN cDNA A230046K03 gene (A230046K03Rik), mRNA Length = 6028 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2834 agtttatgtatgatgagcata 2854
>ref|XM_985835.1| PREDICTED: Mus musculus RIKEN cDNA A230046K03 gene (A230046K03Rik), mRNA Length = 6027 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2834 agtttatgtatgatgagcata 2854
>dbj|AK145000.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN full-length enriched library, clone:G830022O04 product:hypothetical protein, full insert sequence Length = 3519 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2647 agtttatgtatgatgagcata 2667
>dbj|AK161247.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4921509H15 product:hypothetical protein, full insert sequence Length = 3302 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 113 agtttatgtatgatgagcata 133
>dbj|AK166233.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN full-length enriched library, clone:G830022A18 product:hypothetical protein, full insert sequence Length = 3507 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2638 agtttatgtatgatgagcata 2658
>gb|BC026467.1| Mus musculus RIKEN cDNA A230046K03 gene, mRNA (cDNA clone IMAGE:4485556), partial cds Length = 2510 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 1626 agtttatgtatgatgagcata 1646
>gb|BC020314.2| Mus musculus RIKEN cDNA A230046K03 gene, mRNA (cDNA clone IMAGE:5012667), partial cds Length = 3185 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2300 agtttatgtatgatgagcata 2320
>dbj|AK038582.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230046K03 product:hypothetical protein, full insert sequence Length = 3492 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2623 agtttatgtatgatgagcata 2643
>dbj|AK043911.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830049P21 product:hypothetical protein, full insert sequence Length = 3523 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2636 agtttatgtatgatgagcata 2656
>dbj|AK129269.1| Mus musculus mRNA for mKIAA1033 protein Length = 4977 Score = 42.1 bits (21), Expect = 0.46 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 agtttatgtatgatgagcata 123 ||||||||||||||||||||| Sbjct: 2195 agtttatgtatgatgagcata 2215
>dbj|AP004835.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-629D8, complete sequence Length = 134743 Score = 42.1 bits (21), Expect = 0.46 Identities = 24/25 (96%) Strand = Plus / Minus Query: 56 ttaccatacaccaccatacttcatt 80 |||||||||||||||| |||||||| Sbjct: 60485 ttaccatacaccaccaaacttcatt 60461
>gb|AC112719.4| Homo sapiens BAC clone RP11-630D6 from 4, complete sequence Length = 167284 Score = 40.1 bits (20), Expect = 1.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 44 tgctatgctgccttaccata 63 |||||||||||||||||||| Sbjct: 156776 tgctatgctgccttaccata 156795
>gb|AC009343.9| Drosophila melanogaster clone BACR08L17, complete sequence Length = 182492 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 92 aacagatgatgagtttatgtatg 114 ||||||||||| ||||||||||| Sbjct: 171806 aacagatgatgtgtttatgtatg 171784
>gb|BC072867.1| Xenopus laevis MGC80276 protein, mRNA (cDNA clone MGC:80276 IMAGE:5073388), complete cds Length = 3015 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 ccatgtcattgctatgctg 53 ||||||||||||||||||| Sbjct: 2839 ccatgtcattgctatgctg 2821
>gb|AY426266.1| Solanum tarijense blight resistance protein T118 gene, partial cds Length = 3641 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 69 ccatacttcattacccaca 87 ||||||||||||||||||| Sbjct: 2136 ccatacttcattacccaca 2118
>gb|AY426262.1| Solanum bulbocastanum blight resistance protein RGA4 gene, complete cds Length = 3899 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 69 ccatacttcattacccaca 87 ||||||||||||||||||| Sbjct: 2285 ccatacttcattacccaca 2267
>gb|AC158144.13| Mus musculus chromosome 7, clone RP23-82N3, complete sequence Length = 213341 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 85 acagcataacagatgatga 103 ||||||||||||||||||| Sbjct: 5207 acagcataacagatgatga 5225
>emb|AL671309.6| Human DNA sequence from clone RP11-409O11 on chromosome 9 Contains the 5' UTR of the TMEM2 gene for transmembrane protein 2, the 3' end of a novel gene (CGI-67) and a CpG island, complete sequence Length = 117976 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 71 atacttcattacccacagcataa 93 |||||||| |||||||||||||| Sbjct: 61555 atacttcaatacccacagcataa 61533
>gb|AY303171.1| Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence Length = 163635 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 69 ccatacttcattacccaca 87 ||||||||||||||||||| Sbjct: 68889 ccatacttcattacccaca 68907
>gb|AY303170.1| Solanum bulbocastanum chromosome 8 clone CB3A14, complete sequence Length = 79178 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 69 ccatacttcattacccaca 87 ||||||||||||||||||| Sbjct: 60111 ccatacttcattacccaca 60093
>emb|AL354826.6| Human DNA sequence from clone RP11-286M16 on chromosome 1 Contains a novel gene, complete sequence Length = 203279 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 89 cataacagatgatgagtttatgt 111 |||||||||||||||||| |||| Sbjct: 27734 cataacagatgatgagttcatgt 27712
>emb|AL139114.12| Human DNA sequence from clone RP11-328C23 on chromosome 9p22.3-24.1, complete sequence Length = 132139 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 37 atgtcattgctatgctgcc 55 ||||||||||||||||||| Sbjct: 71150 atgtcattgctatgctgcc 71168
>emb|AL731714.9| Mouse DNA sequence from clone RP23-117H24 on chromosome 11 Contains the gene for a novel protein (4933427E13Rik), complete sequence Length = 208133 Score = 38.2 bits (19), Expect = 7.2 Identities = 25/27 (92%) Strand = Plus / Plus Query: 19 gcaggagcaggcctagccatgtcattg 45 |||||||||||| |||||||| ||||| Sbjct: 71682 gcaggagcaggcatagccatgacattg 71708
>emb|BX537344.8| Zebrafish DNA sequence from clone RP71-34B6 in linkage group 2, complete sequence Length = 174019 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 taacagatgatgagtttat 109 ||||||||||||||||||| Sbjct: 129721 taacagatgatgagtttat 129739
>ref|NM_136764.2| Drosophila melanogaster CG12340-RA (CG12340), mRNA Length = 4794 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Plus Query: 92 aacagatgatgagtttatgtatg 114 ||||||||||| ||||||||||| Sbjct: 890 aacagatgatgtgtttatgtatg 912
>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome Length = 859006 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 taacagatgatgagtttat 109 ||||||||||||||||||| Sbjct: 211876 taacagatgatgagtttat 211858
>gb|AC008260.5|AC008260 Drosophila melanogaster, chromosome 2R, region 47B-47C, BAC clone BACR13J10, complete sequence Length = 140940 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 92 aacagatgatgagtttatgtatg 114 ||||||||||| ||||||||||| Sbjct: 2770 aacagatgatgtgtttatgtatg 2748
>gb|AC104921.9| Mus musculus chromosome 7, clone RP23-474B13, complete sequence Length = 182487 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Minus Query: 85 acagcataacagatgatga 103 ||||||||||||||||||| Sbjct: 29454 acagcataacagatgatga 29436
>emb|BX510342.7| Zebrafish DNA sequence from clone DKEY-15I15 in linkage group 2, complete sequence Length = 186711 Score = 38.2 bits (19), Expect = 7.2 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 taacagatgatgagtttat 109 ||||||||||||||||||| Sbjct: 130998 taacagatgatgagtttat 131016
>gb|AF145688.1|AF145688 Drosophila melanogaster clone LD26050 BcDNA.LD26050 (BcDNA.LD26050) mRNA, complete cds Length = 4812 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Plus Query: 92 aacagatgatgagtttatgtatg 114 ||||||||||| ||||||||||| Sbjct: 890 aacagatgatgtgtttatgtatg 912
>gb|AE003828.4| Drosophila melanogaster chromosome 2R, section 22 of 73 of the complete sequence Length = 257907 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 92 aacagatgatgagtttatgtatg 114 ||||||||||| ||||||||||| Sbjct: 163720 aacagatgatgtgtttatgtatg 163698
>dbj|AP003096.3| Homo sapiens genomic DNA, chromosome 11 clone:CTD-2007L18, complete sequence Length = 174605 Score = 38.2 bits (19), Expect = 7.2 Identities = 22/23 (95%) Strand = Plus / Minus Query: 8 tgccttaccatgcaggagcaggc 30 |||||||| |||||||||||||| Sbjct: 132755 tgccttacaatgcaggagcaggc 132733 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,070,965 Number of Sequences: 3902068 Number of extensions: 1070965 Number of successful extensions: 73738 Number of sequences better than 10.0: 34 Number of HSP's better than 10.0 without gapping: 34 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 73685 Number of HSP's gapped (non-prelim): 53 length of query: 149 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 128 effective length of database: 17,151,101,840 effective search space: 2195341035520 effective search space used: 2195341035520 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)