ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl45e04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.091
2dbj|AP003487.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.091
3dbj|AK111584.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.091
4dbj|AK103948.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.091
5dbj|AK061962.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.091
6gb|AC133910.6| Mus musculus chromosome 14, clone RP24-484F23, co... 42 1.4
7gb|AC161829.5| Mus musculus 10 BAC RP23-304K21 (Roswell Park Can... 42 1.4
8emb|CR628323.11| Zebrafish DNA sequence from clone DKEY-36G24 in... 42 1.4
9emb|CR457463.6| Zebrafish DNA sequence from clone DKEY-110G19 in... 42 1.4
10gb|AC162381.7| Mus musculus 10 BAC RP24-528B14 (Roswell Park Can... 42 1.4
11gb|AC095029.3| Homo sapiens chromosome 3 clone RP11-208J17, comp... 42 1.4
12gb|AC107624.1| Homo sapiens chromosome 3 clone RP11-744H21, comp... 42 1.4
13gb|AC154409.2| Mus musculus BAC clone RP24-259B4 from chromosome... 42 1.4
14emb|AL772344.4| Mouse DNA sequence from clone RP23-235J15 on chr... 42 1.4
15gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome 40 5.6
16gb|AY790327.1| Pseudomonas sp. KBOS 03 PHA synthase I (phaC1), P... 40 5.6
17gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, c... 40 5.6
18ref|XM_511849.1| PREDICTED: Pan troglodytes similar to Expressed... 40 5.6
19gb|AY753192.1| Homo sapiens p87 phosphoinositide 3-kinase gamma ... 40 5.6
20gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome 40 5.6
21gb|AC102129.9| Mus musculus chromosome 7, clone RP23-220N19, com... 40 5.6
22ref|NM_001010855.1| Homo sapiens chromosome 17 open reading fram... 40 5.6
23gb|AC099057.3| Homo sapiens chromosome 3 clone RP11-655N11, comp... 40 5.6
24gb|AC004605.1|HUAC004605 Homo sapiens Chromosome 16 BAC clone CI... 40 5.6
25ref|XM_845187.1| PREDICTED: Canis familiaris similar to expresse... 40 5.6
26emb|AL357037.13| Human DNA sequence from clone RP11-383B24 on ch... 40 5.6
27emb|AL161780.8| Human DNA sequence from clone RP11-187K16 on chr... 40 5.6
28dbj|AK091819.1| Homo sapiens cDNA FLJ34500 fis, clone HLUNG2005479 40 5.6
29gb|AC105110.5| Homo sapiens chromosome 18, clone CTD-2301P8, com... 40 5.6
30gb|AC108452.3| Homo sapiens chromosome 18, clone RP11-60G10, com... 40 5.6
31gb|AC067819.10| Homo sapiens chromosome 18, clone RP11-585K6, co... 40 5.6
32gb|AC158550.4| Mus musculus chromosome 7, clone RP24-192B7, comp... 40 5.6
33gb|AC040896.9| Homo sapiens chromosome 18, clone RP11-734B5, com... 40 5.6
34gb|AC138627.1| Homo sapiens chromosome 16 clone RP11-42H13, comp... 40 5.6
35gb|AC153071.3| Equus caballus clone CH241-77F8, complete sequence 40 5.6
36gb|AC003695.1|AC003695 Homo sapiens chromosome 17, clone hRPC.85... 40 5.6
37gb|BC110301.1| Homo sapiens cDNA clone IMAGE:5216915, with appar... 40 5.6
38gb|DP000020.1| Equus caballus target 1 genomic scaffold 40 5.6

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                      
Query: 91      atggctattgtaatatgacatatactacacatctgtata 129
               |||||||| ||||| || |||||||||||||||| ||||
Sbjct: 2320018 atggctatggtaatgtggcatatactacacatctctata 2320056



to top

>dbj|AP003487.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0007O20
          Length = 147363

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 91    atggctattgtaatatgacatatactacacatctgtata 129
             |||||||| ||||| || |||||||||||||||| ||||
Sbjct: 41819 atggctatggtaatgtggcatatactacacatctctata 41857



to top

>dbj|AK111584.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013089O14, full
            insert sequence
          Length = 3391

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 91   atggctattgtaatatgacatatactacacatctgtata 129
            |||||||| ||||| || |||||||||||||||| ||||
Sbjct: 3202 atggctatggtaatgtggcatatactacacatctctata 3164



to top

>dbj|AK103948.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B05, full
            insert sequence
          Length = 1452

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 91   atggctattgtaatatgacatatactacacatctgtata 129
            |||||||| ||||| || |||||||||||||||| ||||
Sbjct: 1263 atggctatggtaatgtggcatatactacacatctctata 1225



to top

>dbj|AK061962.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-G04, full
            insert sequence
          Length = 1490

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 91   atggctattgtaatatgacatatactacacatctgtata 129
            |||||||| ||||| || |||||||||||||||| ||||
Sbjct: 1378 atggctatggtaatgtggcatatactacacatctctata 1340



to top

>gb|AC133910.6| Mus musculus chromosome 14, clone RP24-484F23, complete sequence
          Length = 235453

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 379   atgttccatcataaaattggg 399
             |||||||||||||||||||||
Sbjct: 21353 atgttccatcataaaattggg 21373



to top

>gb|AC161829.5| Mus musculus 10 BAC RP23-304K21 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 196522

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 29    gaatagtaacacacaattaca 49
             |||||||||||||||||||||
Sbjct: 33063 gaatagtaacacacaattaca 33083



to top

>emb|CR628323.11| Zebrafish DNA sequence from clone DKEY-36G24 in linkage group 17,
             complete sequence
          Length = 154249

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    ttttcatctcctacaaggttg 88
             |||||||||||||||||||||
Sbjct: 83011 ttttcatctcctacaaggttg 83031



to top

>emb|CR457463.6| Zebrafish DNA sequence from clone DKEY-110G19 in linkage group 4,
             complete sequence
          Length = 145220

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 187   cagtacatggaaaattgggta 207
             |||||||||||||||||||||
Sbjct: 83014 cagtacatggaaaattgggta 83034



to top

>gb|AC162381.7| Mus musculus 10 BAC RP24-528B14 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 150712

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 29    gaatagtaacacacaattaca 49
             |||||||||||||||||||||
Sbjct: 96744 gaatagtaacacacaattaca 96724



to top

>gb|AC095029.3| Homo sapiens chromosome 3 clone RP11-208J17, complete sequence
          Length = 151787

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 53     attggctatagaaaattttca 73
              |||||||||||||||||||||
Sbjct: 116236 attggctatagaaaattttca 116216



to top

>gb|AC107624.1| Homo sapiens chromosome 3 clone RP11-744H21, complete sequence
          Length = 170282

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 53     attggctatagaaaattttca 73
              |||||||||||||||||||||
Sbjct: 143821 attggctatagaaaattttca 143841



to top

>gb|AC154409.2| Mus musculus BAC clone RP24-259B4 from chromosome 14, complete sequence
          Length = 196997

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 379   atgttccatcataaaattggg 399
             |||||||||||||||||||||
Sbjct: 70291 atgttccatcataaaattggg 70271



to top

>emb|AL772344.4| Mouse DNA sequence from clone RP23-235J15 on chromosome 4, complete
              sequence
          Length = 223771

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 162    aactctgcacccaacccatct 182
              |||||||||||||||||||||
Sbjct: 193700 aactctgcacccaacccatct 193720



to top

>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome
          Length = 4222334

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     ttcagtacatggaaaattgg 204
               ||||||||||||||||||||
Sbjct: 3492027 ttcagtacatggaaaattgg 3492008



to top

>gb|AY790327.1| Pseudomonas sp. KBOS 03 PHA synthase I (phaC1), PHA depolymerase
            (phaZ), and PHA synthase II (phaC2) genes, complete cds
          Length = 4617

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 162  aactctgcacccaacccatc 181
            ||||||||||||||||||||
Sbjct: 3135 aactctgcacccaacccatc 3154



to top

>gb|AC161194.14| Mus musculus chromosome 15, clone RP23-345C13, complete sequence
          Length = 193998

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 252   aaacaagcctgccaagattgattc 275
             |||||| |||||||||||||||||
Sbjct: 29419 aaacaaccctgccaagattgattc 29396



to top

>ref|XM_511849.1| PREDICTED: Pan troglodytes similar to Expressed sequence BB220380
            (LOC455087), mRNA
          Length = 3212

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  gcacccaacccatctatttc 187
            ||||||||||||||||||||
Sbjct: 1631 gcacccaacccatctatttc 1650



to top

>gb|AY753192.1| Homo sapiens p87 phosphoinositide 3-kinase gamma adapter protein
            mRNA, complete cds
          Length = 2265

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  gcacccaacccatctatttc 187
            ||||||||||||||||||||
Sbjct: 1589 gcacccaacccatctatttc 1608



to top

>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome
          Length = 4222645

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     ttcagtacatggaaaattgg 204
               ||||||||||||||||||||
Sbjct: 3492198 ttcagtacatggaaaattgg 3492179



to top

>gb|AC102129.9| Mus musculus chromosome 7, clone RP23-220N19, complete sequence
          Length = 178200

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 61    tagaaaattttcatctcctacaag 84
             ||||||||||||||||||| ||||
Sbjct: 91120 tagaaaattttcatctcctccaag 91143



to top

>ref|NM_001010855.1| Homo sapiens chromosome 17 open reading frame 38 (C17orf38), mRNA
          Length = 2265

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  gcacccaacccatctatttc 187
            ||||||||||||||||||||
Sbjct: 1589 gcacccaacccatctatttc 1608



to top

>gb|AC099057.3| Homo sapiens chromosome 3 clone RP11-655N11, complete sequence
          Length = 164323

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 253   aacaagcctgccaagattga 272
             ||||||||||||||||||||
Sbjct: 98913 aacaagcctgccaagattga 98932



to top

>gb|AC004605.1|HUAC004605 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-248F7, complete sequence
          Length = 259474

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 80     acaaggttgttatggctattgtaatatg 107
              ||||||| ||||||| ||||||||||||
Sbjct: 189518 acaaggtggttatggttattgtaatatg 189545



to top

>ref|XM_845187.1| PREDICTED: Canis familiaris similar to expressed sequence BB220380
            (LOC608225), mRNA
          Length = 2292

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  gcacccaacccatctatttc 187
            ||||||||||||||||||||
Sbjct: 1622 gcacccaacccatctatttc 1641



to top

>emb|AL357037.13| Human DNA sequence from clone RP11-383B24 on chromosome 10 Contains the
              3' end of a 44kDA polymerase (RNA) III (DNA directed)
              polypeptide D (POLR3D) pseudogene, the 3' end of the ADK
              gene for adenosine kinase and a novel pseudogene, complete
              sequence
          Length = 165773

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    ctgcacccaacccatctatt 185
              ||||||||||||||||||||
Sbjct: 153051 ctgcacccaacccatctatt 153032



to top

>emb|AL161780.8| Human DNA sequence from clone RP11-187K16 on chromosome 9, complete
             sequence
          Length = 51553

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 59    tatagaaaattttcatctcctacaaggttgtt 90
             ||||||||||||||||| |||| ||| |||||
Sbjct: 41281 tatagaaaattttcatcacctaaaagcttgtt 41312



to top

>dbj|AK091819.1| Homo sapiens cDNA FLJ34500 fis, clone HLUNG2005479
          Length = 3293

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  gcacccaacccatctatttc 187
            ||||||||||||||||||||
Sbjct: 1926 gcacccaacccatctatttc 1945



to top

>gb|AC105110.5| Homo sapiens chromosome 18, clone CTD-2301P8, complete sequence
          Length = 95735

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 87    tgttatggctattgtaatatgaca 110
             |||||||||||| |||||||||||
Sbjct: 58954 tgttatggctatagtaatatgaca 58931



to top

>gb|AC108452.3| Homo sapiens chromosome 18, clone RP11-60G10, complete sequence
          Length = 160769

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 87    tgttatggctattgtaatatgaca 110
             |||||||||||| |||||||||||
Sbjct: 36721 tgttatggctatagtaatatgaca 36698



to top

>gb|AC067819.10| Homo sapiens chromosome 18, clone RP11-585K6, complete sequence
          Length = 216972

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   atttcagtacatggaaaatt 202
             ||||||||||||||||||||
Sbjct: 37595 atttcagtacatggaaaatt 37576



to top

>gb|AC158550.4| Mus musculus chromosome 7, clone RP24-192B7, complete sequence
          Length = 169846

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 61    tagaaaattttcatctcctacaag 84
             ||||||||||||||||||| ||||
Sbjct: 28600 tagaaaattttcatctcctccaag 28623



to top

>gb|AC040896.9| Homo sapiens chromosome 18, clone RP11-734B5, complete sequence
          Length = 189308

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   atttcagtacatggaaaatt 202
             ||||||||||||||||||||
Sbjct: 14431 atttcagtacatggaaaatt 14450



to top

>gb|AC138627.1| Homo sapiens chromosome 16 clone RP11-42H13, complete sequence
          Length = 170920

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 80     acaaggttgttatggctattgtaatatg 107
              ||||||| ||||||| ||||||||||||
Sbjct: 127796 acaaggtggttatggttattgtaatatg 127823



to top

>gb|AC153071.3| Equus caballus clone CH241-77F8, complete sequence
          Length = 245146

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 394    attgggattgtaattgttta 413
              ||||||||||||||||||||
Sbjct: 232094 attgggattgtaattgttta 232113



to top

>gb|AC003695.1|AC003695 Homo sapiens chromosome 17, clone hRPC.859_O_20, complete sequence
          Length = 115199

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   gcacccaacccatctatttc 187
             ||||||||||||||||||||
Sbjct: 95703 gcacccaacccatctatttc 95722



to top

>gb|BC110301.1| Homo sapiens cDNA clone IMAGE:5216915, with apparent retained intron
          Length = 3435

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 168  gcacccaacccatctatttc 187
            ||||||||||||||||||||
Sbjct: 2180 gcacccaacccatctatttc 2199



to top

>gb|DP000020.1| Equus caballus target 1 genomic scaffold
          Length = 1907055

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 394    attgggattgtaattgttta 413
              ||||||||||||||||||||
Sbjct: 232094 attgggattgtaattgttta 232113


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,937,502
Number of Sequences: 3902068
Number of extensions: 3937502
Number of successful extensions: 74019
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73886
Number of HSP's gapped (non-prelim): 133
length of query: 418
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 396
effective length of database: 17,147,199,772
effective search space: 6790291109712
effective search space used: 6790291109712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top