>gb|AY491010.1| Leishmania major Hut1L protein (Hut1L) gene, complete cds
          Length = 1732

 Score = 42.1 bits (21), Expect = 0.23
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 46  taacgcgcgcggtaccacaca 66
           |||||||||||||||||||||
Sbjct: 675 taacgcgcgcggtaccacaca 655

>emb|CR450779.7| Zebrafish DNA sequence from clone CH211-258C22 in linkage group 5,
              complete sequence
          Length = 179980

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      aacaaaattatgcactgaaa 24
              ||||||||||||||||||||
Sbjct: 125048 aacaaaattatgcactgaaa 125029

>emb|BX322651.3| Zebrafish DNA sequence from clone DKEYP-32G10, complete sequence
          Length = 152913

 Score = 40.1 bits (20), Expect = 0.89
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     aacaaaattatgcactgaaa 24
             ||||||||||||||||||||
Sbjct: 71960 aacaaaattatgcactgaaa 71979

>gb|AC145507.3| Dasypus novemcinctus clone VMRC5-137J5, complete sequence
          Length = 109381

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1    ggggaacaaaattatgcac 19
            |||||||||||||||||||
Sbjct: 8961 ggggaacaaaattatgcac 8979

>gb|AC112150.4| Mus musculus BAC clone RP24-84I17 from chromosome 16, complete sequence
          Length = 211640

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 8     aaaattatgcactgaaaaa 26
             |||||||||||||||||||
Sbjct: 19008 aaaattatgcactgaaaaa 19026

>emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome
          Length = 1581384

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 4      gaacaaaattatgcactgaaaaa 26
              |||||||| ||||||||||||||
Sbjct: 789585 gaacaaaactatgcactgaaaaa 789607

>gb|AC008716.7| Homo sapiens chromosome 5 clone CTB-85P21, complete sequence
          Length = 184589

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     tatgcactgaaaaaatgga 31
              |||||||||||||||||||
Sbjct: 166422 tatgcactgaaaaaatgga 166404

>dbj|AB006708.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYJ24
          Length = 78844

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 5     aacaaaattatgcactgaaaaaa 27
             |||||||||||| ||||||||||
Sbjct: 46250 aacaaaattatgaactgaaaaaa 46272

>emb|CT010517.11| Mouse DNA sequence from clone RP23-357P12 on chromosome 16, complete
              sequence
          Length = 188228

 Score = 38.2 bits (19), Expect = 3.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 8      aaaattatgcactgaaaaa 26
              |||||||||||||||||||
Sbjct: 139227 aaaattatgcactgaaaaa 139209


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 659,639
Number of Sequences: 3902068
Number of extensions: 659639
Number of successful extensions: 34087
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34072
Number of HSP's gapped (non-prelim): 15
length of query: 84
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 63
effective length of database: 17,151,101,840
effective search space: 1080519415920
effective search space used: 1080519415920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)