ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl45b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC116329.3| Mus musculus BAC clone RP24-290C19 from 5, comple... 42 1.2
2emb|AL356952.18| Human DNA sequence from clone RP11-809M12 on ch... 42 1.2
3emb|AL138997.18| Human DNA sequence from clone RP11-10O23 on chr... 42 1.2
4emb|CR390310.1| Gallus gallus finished cDNA, clone ChEST234p17 42 1.2
5gb|AC097489.2| Homo sapiens BAC clone RP11-226A18 from 4, comple... 40 4.7
6gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosom... 40 4.7
7emb|BX004822.12| Zebrafish DNA sequence from clone DKEY-18F18, c... 40 4.7

>gb|AC116329.3| Mus musculus BAC clone RP24-290C19 from 5, complete sequence
          Length = 170072

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 91    ccgtagataaaaattacaacg 111
             |||||||||||||||||||||
Sbjct: 86431 ccgtagataaaaattacaacg 86411



to top

>emb|AL356952.18| Human DNA sequence from clone RP11-809M12 on chromosome 10 Contains a
             novel gene and a CpG island, complete sequence
          Length = 129950

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 238   aaacactgcagaaactctcca 258
             |||||||||||||||||||||
Sbjct: 94033 aaacactgcagaaactctcca 94053



to top

>emb|AL138997.18| Human DNA sequence from clone RP11-10O23 on chromosome 13 Contains a
              hepatocyte nuclear factor 4 alpha (HNF4A) pseudogene,
              complete sequence
          Length = 172342

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 238    aaacactgcagaaactctcca 258
              |||||||||||||||||||||
Sbjct: 159807 aaacactgcagaaactctcca 159787



to top

>emb|CR390310.1| Gallus gallus finished cDNA, clone ChEST234p17
          Length = 1645

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 282 gtatgaaaacagccattcctt 302
           |||||||||||||||||||||
Sbjct: 495 gtatgaaaacagccattcctt 475



to top

>gb|AC097489.2| Homo sapiens BAC clone RP11-226A18 from 4, complete sequence
          Length = 152039

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 96    gataaaaattacaacgttat 115
             ||||||||||||||||||||
Sbjct: 81064 gataaaaattacaacgttat 81045



to top

>gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosome 17, complete
             sequence
          Length = 181773

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   gaaactctccatgttctact 267
             ||||||||||||||||||||
Sbjct: 59334 gaaactctccatgttctact 59315



to top

>emb|BX004822.12| Zebrafish DNA sequence from clone DKEY-18F18, complete sequence
          Length = 201902

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     atcctcaaagtaagacaatt 22
             ||||||||||||||||||||
Sbjct: 46106 atcctcaaagtaagacaatt 46087


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,001,427
Number of Sequences: 3902068
Number of extensions: 3001427
Number of successful extensions: 48186
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48176
Number of HSP's gapped (non-prelim): 10
length of query: 355
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 333
effective length of database: 17,147,199,772
effective search space: 5710017524076
effective search space used: 5710017524076
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top