>gb|AC136710.8| Mus musculus chromosome 19, clone RP23-35B13, complete sequence
          Length = 206056

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    cattcatatgaaggaaggtg 80
             ||||||||||||||||||||
Sbjct: 48351 cattcatatgaaggaaggtg 48332

>gb|AC147234.3| Mus musculus BAC clone RP24-500F11 from chromosome 18, complete
             sequence
          Length = 189846

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   tatatatgtatacaacctac 187
             ||||||||||||||||||||
Sbjct: 57885 tatatatgtatacaacctac 57904

>gb|AC122211.4| Mus musculus BAC clone RP23-97F18 from chromosome 18, complete sequence
          Length = 186451

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 168   tatatatgtatacaacctac 187
             ||||||||||||||||||||
Sbjct: 59572 tatatatgtatacaacctac 59553

>gb|AC126431.3| Mus musculus BAC clone RP24-407P8 from chromosome 6, complete sequence
          Length = 144924

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    aggaaggtgactgctttaga 91
             ||||||||||||||||||||
Sbjct: 67014 aggaaggtgactgctttaga 66995

>gb|AC164616.4| Mus musculus BAC clone RP23-322A5 from chromosome 12, complete sequence
          Length = 204974

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 140    tgtatcattggtgcttctag 159
              ||||||||||||||||||||
Sbjct: 191757 tgtatcattggtgcttctag 191776

>emb|AL355347.16| Human DNA sequence from clone RP11-506N21 on chromosome 6 Contains part
             of the KHDRBS2 gene for KH domain containing RNA binding
             signal transduction associated protein 2, complete
             sequence
          Length = 86298

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    cactgacaatgacattgcta 54
             ||||||||||||||||||||
Sbjct: 16100 cactgacaatgacattgcta 16081

>gb|AC131956.1| Homo sapiens BAC clone RP11-793B23 from 4, complete sequence
          Length = 195404

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 127    tactagaaaagattgtatcattgg 150
              |||||||||||||||||| |||||
Sbjct: 146037 tactagaaaagattgtattattgg 146014

>gb|AC094022.3| Homo sapiens chromosome 1 clone RP11-88N11, complete sequence
          Length = 187268

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 130   tagaaaagattgtatcattg 149
             ||||||||||||||||||||
Sbjct: 93351 tagaaaagattgtatcattg 93370

>gb|AC160112.2| Mus musculus BAC clone RP24-80F17 from chromosome 12, complete sequence
          Length = 230823

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 140    tgtatcattggtgcttctag 159
              ||||||||||||||||||||
Sbjct: 120907 tgtatcattggtgcttctag 120888


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,154,346
Number of Sequences: 3902068
Number of extensions: 3154346
Number of successful extensions: 68324
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68293
Number of HSP's gapped (non-prelim): 31
length of query: 304
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 282
effective length of database: 17,147,199,772
effective search space: 4835510335704
effective search space used: 4835510335704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)