Clone Information

BLAST Search Result

Clone Name	rbastl44h06
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|AL512290.11\| Human DNA sequence from clone RP13-143G15 on ch...	44	0.36
2	gb\|BC052305.1\| Homo sapiens development and differentiation enha...	42	1.4
3	gb\|BC023519.2\| Homo sapiens development and differentiation enha...	42	1.4
4	ref\|XM_513193.1\| PREDICTED: Pan troglodytes similar to up-regula...	42	1.4
5	gb\|AF064864.1\| Homo sapiens chromosome 21q22.3 PAC 21L13, comple...	42	1.4
6	emb\|AL163283.2\|HS21C083 Homo sapiens chromosome 21 segment HS21C083	42	1.4
7	emb\|AL357134.13\| Human DNA sequence from clone RP4-654C18 on chr...	42	1.4
8	gb\|BC060786.1\| Homo sapiens development and differentiation enha...	42	1.4
9	emb\|CR609624.1\| full-length cDNA clone CS0DI032YN12 of Placenta ...	42	1.4
10	dbj\|AK092291.1\| Homo sapiens cDNA FLJ34972 fis, clone NTONG20053...	42	1.4
11	gb\|AF064866.2\|AF064866 Homo sapiens chromosome 21 clone PAC 198E...	42	1.4
12	dbj\|AK000206.1\| Homo sapiens cDNA FLJ20199 fis, clone COLF1162	42	1.4
13	dbj\|AK074319.1\| Homo sapiens cDNA FLJ23739 fis, clone HEP15286	42	1.4
14	emb\|CT010449.10\| Mouse DNA sequence from clone RP23-347O24 on ch...	42	1.4
15	ref\|NM_017707.2\| Homo sapiens development and differentiation en...	42	1.4
16	dbj\|AB056749.1\| Homo sapiens UPLC1 mRNA for up-regulated in live...	42	1.4
17	gb\|AC117590.14\| Mus musculus chromosome 3, clone RP23-225F12, co...	40	5.7
18	gb\|AE005674.1\| Shigella flexneri 2a str. 301, complete genome	40	5.7
19	gb\|AC123613.16\| Mus musculus chromosome 1, clone RP23-434L2, com...	40	5.7
20	gb\|AC111093.10\| Mus musculus chromosome 3, clone RP23-170E22, co...	40	5.7
21	gb\|AC104231.10\| Homo sapiens chromosome 15, clone RP11-96H23, co...	40	5.7
22	gb\|AE014075.1\| Escherichia coli CFT073, complete genome	40	5.7
23	gb\|CP000243.1\| Escherichia coli UTI89, complete genome	40	5.7
24	emb\|AL732423.12\| Human DNA sequence from clone RP11-345L8 on chr...	40	5.7
25	emb\|AL591896.6\| Human DNA sequence from clone RP11-422P22 on chr...	40	5.7
26	emb\|AL139010.29\| Human DNA sequence from clone RP11-444M10 on ch...	40	5.7
27	dbj\|AK056173.1\| Homo sapiens cDNA FLJ31611 fis, clone NT2RI2002923	40	5.7
28	gb\|AC091843.3\| Homo sapiens chromosome 5 clone CTD-2185O23, comp...	40	5.7
29	gb\|AC069082.9\| Homo sapiens chromosome 15, clone RP11-716C8, com...	40	5.7
30	gb\|AC010928.7\|AC010928 Homo sapiens chromosome 18, clone RP11-32...	40	5.7
31	gb\|AC069272.18\|AC069272 Homo sapiens chromosome 4 clone RP11-76G...	40	5.7
32	gb\|AC068274.5\| Homo sapiens BAC clone RP11-119B15 from 2, comple...	40	5.7
33	gb\|AC012514.29\| Homo sapiens 12 BAC RP11-837P6 (Roswell Park Can...	40	5.7
34	gb\|AE014073.1\| Shigella flexneri 2a str. 2457T, complete genome	40	5.7
35	gb\|AE008384.1\| Methanosarcina mazei strain Goe1, complete genome	40	5.7
36	gb\|AE005174.2\| Escherichia coli O157:H7 EDL933, complete genome	40	5.7
37	dbj\|BA000007.2\| Escherichia coli O157:H7 DNA, complete genome	40	5.7
38	gb\|CP000034.1\| Shigella dysenteriae Sd197, complete genome	40	5.7
39	emb\|AL844590.3\| Mouse DNA sequence from clone RP23-335P15 on chr...	40	5.7
40	gb\|CP000036.1\| Shigella boydii Sb227, complete genome	40	5.7

>emb|AL512290.11| Human DNA sequence from clone RP13-143G15 on chromosome 6 Contains a
             cytochrome c oxidase subunit Vb (COX5B) pseudogene, a
             novel gene and part of a novel gene, complete sequence
          Length = 133918

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 249   tcctgaaaaaccaacataaacc 270
             ||||||||||||||||||||||
Sbjct: 22228 tcctgaaaaaccaacataaacc 22207

to top

>gb|BC052305.1| Homo sapiens development and differentiation enhancing factor-like 1,
            mRNA (cDNA clone IMAGE:6377039), partial cds
          Length = 2609

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 1231 ccttgagccatctccttcagtgatg 1207

to top

>gb|BC023519.2| Homo sapiens development and differentiation enhancing factor-like
           1, mRNA (cDNA clone IMAGE:4109503), complete cds
          Length = 2249

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 394 ccttgaggcatctccttcagtgatg 418
           ||||||| |||||||||||||||||
Sbjct: 888 ccttgagccatctccttcagtgatg 864

to top

>ref|XM_513193.1| PREDICTED: Pan troglodytes similar to up-regulated in liver cancer 1;
            similar to development- and differentiation-enhancing
            factor 2 (LOC456617), mRNA
          Length = 2694

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 2649 ccttgagccatctccttcagtgatg 2625

to top

>gb|AF064864.1| Homo sapiens chromosome 21q22.3 PAC 21L13, complete sequence
          Length = 120007

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 144    ttacaactcttttaagtagat 164
              |||||||||||||||||||||
Sbjct: 113718 ttacaactcttttaagtagat 113738

to top

>emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 144    ttacaactcttttaagtagat 164
              |||||||||||||||||||||
Sbjct: 198981 ttacaactcttttaagtagat 199001

to top

>emb|AL357134.13| Human DNA sequence from clone RP4-654C18 on chromosome 1 Contains the
             5' end of the TCEA3 gene for transcription elongation
             factor A (SII) 3, a single-stranded DNA binding protein
             (SSBP1) pseudogene, the 3' end of the gene for
             up-regulated in liver cancer 1 (UPLC1) (FLJ34972,
             FLJ20199, FLJ20246) and a CpG island, complete sequence
          Length = 66464

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 394   ccttgaggcatctccttcagtgatg 418
             ||||||| |||||||||||||||||
Sbjct: 44131 ccttgagccatctccttcagtgatg 44155

to top

>gb|BC060786.1| Homo sapiens development and differentiation enhancing factor-like 1,
            mRNA (cDNA clone MGC:71572 IMAGE:5298355), complete cds
          Length = 4094

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 2739 ccttgagccatctccttcagtgatg 2715

to top

>emb|CR609624.1| full-length cDNA clone CS0DI032YN12 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 2682

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 1377 ccttgagccatctccttcagtgatg 1353

to top

>dbj|AK092291.1| Homo sapiens cDNA FLJ34972 fis, clone NTONG2005391, weakly similar to
            Bos taurus differentiation enhancing factor 1 (DEF-1)
            mRNA
          Length = 3812

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 2713 ccttgagccatctccttcagtgatg 2689

to top

>gb|AF064866.2|AF064866 Homo sapiens chromosome 21 clone PAC 198E8, map 21q22.3, complete
             sequence
          Length = 119847

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 144   ttacaactcttttaagtagat 164
             |||||||||||||||||||||
Sbjct: 12292 ttacaactcttttaagtagat 12312

to top

>dbj|AK000206.1| Homo sapiens cDNA FLJ20199 fis, clone COLF1162
          Length = 2623

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 1215 ccttgagccatctccttcagtgatg 1191

to top

>dbj|AK074319.1| Homo sapiens cDNA FLJ23739 fis, clone HEP15286
          Length = 2430

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 1074 ccttgagccatctccttcagtgatg 1050

to top

>emb|CT010449.10| Mouse DNA sequence from clone RP23-347O24 on chromosome 12, complete
              sequence
          Length = 203697

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 298    tgtacctcccattcttcttcc 318
              |||||||||||||||||||||
Sbjct: 100965 tgtacctcccattcttcttcc 100985

to top

>ref|NM_017707.2| Homo sapiens development and differentiation enhancing factor-like 1
            (DDEFL1), mRNA
          Length = 4050

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 2712 ccttgagccatctccttcagtgatg 2688

to top

>dbj|AB056749.1| Homo sapiens UPLC1 mRNA for up-regulated in liver cancer 1, complete
            cds
          Length = 4050

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 394  ccttgaggcatctccttcagtgatg 418
            ||||||| |||||||||||||||||
Sbjct: 2712 ccttgagccatctccttcagtgatg 2688

to top

>gb|AC117590.14| Mus musculus chromosome 3, clone RP23-225F12, complete sequence
          Length = 180451

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     acaactcttttagataaaag 75
              ||||||||||||||||||||
Sbjct: 151176 acaactcttttagataaaag 151157

to top

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 2791503 tactttatccatttcctgaa 2791484

to top

>gb|AC123613.16| Mus musculus chromosome 1, clone RP23-434L2, complete sequence
          Length = 204785

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 114   agaaactgatagtagtttat 133
             ||||||||||||||||||||
Sbjct: 42779 agaaactgatagtagtttat 42798

to top

>gb|AC111093.10| Mus musculus chromosome 3, clone RP23-170E22, complete sequence
          Length = 201202

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     acaactcttttagataaaag 75
              ||||||||||||||||||||
Sbjct: 199327 acaactcttttagataaaag 199346

to top

>gb|AC104231.10| Homo sapiens chromosome 15, clone RP11-96H23, complete sequence
          Length = 81256

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    cagtatcccagttttccact 107
             ||||||||||||||||||||
Sbjct: 49820 cagtatcccagttttccact 49839

to top

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 3100200 tactttatccatttcctgaa 3100181

to top

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 2976404 tactttatccatttcctgaa 2976385

to top

>emb|AL732423.12| Human DNA sequence from clone RP11-345L8 on chromosome X Contains the
             3' end of the SH3KBP1 gene for SH3-domain kinase binding
             protein 1 (CIN85) and the 5' end of the gene for a novel
             protein similar to mitogen-activated protein kinase kinase
             kinase 5 (MAP3K5), complete sequence
          Length = 173520

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   cactagcagcagaaactgat 123
             ||||||||||||||||||||
Sbjct: 73001 cactagcagcagaaactgat 73020

to top

>emb|AL591896.6| Human DNA sequence from clone RP11-422P22 on chromosome 1 Contains a gene
              for a novel protein containing Kelch motif and a putative
              novel gene, complete sequence
          Length = 117320

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 290    tgctctggtgtacctcccat 309
              ||||||||||||||||||||
Sbjct: 102823 tgctctggtgtacctcccat 102804

to top

>emb|AL139010.29| Human DNA sequence from clone RP11-444M10 on chromosome 1 Contains the 3'
              end of a novel gene, a novel gene and the KIRREL gene for
              kin of IRRE like (Drosophila), complete sequence
          Length = 189477

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 396    ttgaggcatctccttcagtg 415
              ||||||||||||||||||||
Sbjct: 132550 ttgaggcatctccttcagtg 132569

to top

>dbj|AK056173.1| Homo sapiens cDNA FLJ31611 fis, clone NT2RI2002923
          Length = 2167

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 290 tgctctggtgtacctcccat 309
           ||||||||||||||||||||
Sbjct: 719 tgctctggtgtacctcccat 700

to top

>gb|AC091843.3| Homo sapiens chromosome 5 clone CTD-2185O23, complete sequence
          Length = 177056

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 238    ctttatccatttcctgaaaaaccaacat 265
              |||||| ||||| |||||||||||||||
Sbjct: 149395 ctttatacattttctgaaaaaccaacat 149422

to top

>gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, complete sequence
          Length = 163533

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    cagtatcccagttttccact 107
             ||||||||||||||||||||
Sbjct: 11211 cagtatcccagttttccact 11230

to top

>gb|AC010928.7|AC010928 Homo sapiens chromosome 18, clone RP11-325K19, complete sequence
          Length = 213552

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 238    ctttatccatttcctgaaaaaccaacat 265
              |||||| ||||| |||||||||||||||
Sbjct: 144875 ctttatacattttctgaaaaaccaacat 144848

to top

>gb|AC069272.18|AC069272 Homo sapiens chromosome 4 clone RP11-76G10, complete sequence
          Length = 160359

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     acaactcttttagataaaag 75
              ||||||||||||||||||||
Sbjct: 121424 acaactcttttagataaaag 121405

to top

>gb|AC068274.5| Homo sapiens BAC clone RP11-119B15 from 2, complete sequence
          Length = 118955

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    agataaaagggagactagac 86
             ||||||||||||||||||||
Sbjct: 38512 agataaaagggagactagac 38493

to top

>gb|AC012514.29| Homo sapiens 12 BAC RP11-837P6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 52784

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 274   ttgatgtgactaatcttgct 293
             ||||||||||||||||||||
Sbjct: 22848 ttgatgtgactaatcttgct 22867

to top

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 2786137 tactttatccatttcctgaa 2786118

to top

>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     catttcctgaaaaaccaaca 264
               ||||||||||||||||||||
Sbjct: 1696084 catttcctgaaaaaccaaca 1696103

to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 3609052 tactttatccatttcctgaa 3609033

to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 3541762 tactttatccatttcctgaa 3541743

to top

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 2671651 tactttatccatttcctgaa 2671632

to top

>emb|AL844590.3| Mouse DNA sequence from clone RP23-335P15 on chromosome 2, complete
              sequence
          Length = 231459

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 246    atttcctgaaaaaccaacat 265
              ||||||||||||||||||||
Sbjct: 174937 atttcctgaaaaaccaacat 174956

to top

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 236     tactttatccatttcctgaa 255
               ||||||||||||||||||||
Sbjct: 2834142 tactttatccatttcctgaa 2834161


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,000,431
Number of Sequences: 3902068
Number of extensions: 4000431
Number of successful extensions: 80451
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80309
Number of HSP's gapped (non-prelim): 142
length of query: 423
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 401
effective length of database: 17,147,199,772
effective search space: 6876027108572
effective search space used: 6876027108572
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result