ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl44g05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB193551.1| Triticum aestivum WP5CS mRNA for delta1-pyrrolin... 56 8e-05
2gb|AC109351.3| Homo sapiens BAC clone RP11-417M17 from 4, comple... 44 0.30
3emb|AL356094.11| Human DNA sequence from clone RP11-64I5 on chro... 42 1.2
4gb|AC101940.17| Mus musculus chromosome 3, clone RP24-111E3, com... 42 1.2
5gb|AC158134.8| Mus musculus chromosome 3, clone RP24-384O20, com... 42 1.2
6gb|AC006369.3| Homo sapiens BAC clone RP11-278G12 from 2, comple... 42 1.2
7gb|AC163686.3| Mus musculus BAC clone RP23-3C10 from chromosome ... 40 4.7
8gb|AC046160.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 4.7
9gb|AC126929.3| Mus musculus BAC clone RP24-465A20 from chromosom... 40 4.7
10gb|AC149546.14| Medicago truncatula clone mth2-70o13, complete s... 40 4.7
11gb|AC138453.8| Medicago truncatula clone mth2-20m14, complete se... 40 4.7
12emb|AL022100.13|HS1059H15 Human DNA sequence from clone RP5-1059... 40 4.7
13gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete s... 40 4.7
14gb|AC062031.7| Homo sapiens BAC clone RP11-474G7 from 2, complet... 40 4.7
15dbj|AP001666.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 4.7
16gb|AC146753.1| Gallus gallus BAC clone CH261-4N19 from chromosom... 40 4.7
17dbj|AP001343.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 4.7

>dbj|AB193551.1| Triticum aestivum WP5CS mRNA for delta1-pyrroline-5-carboxylate
            synthetase, complete cds
          Length = 2405

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 82/98 (83%), Gaps = 4/98 (4%)
 Strand = Plus / Minus

                                                                        
Query: 157  attataaccctggaaatccggagcctccaagctcatacaaactgatctaccaaaccacca 216
            |||||||| | ||| | ||| |||||||||||||||||||| ||||| ||| | || |||
Sbjct: 2404 attataacaccggagagccgaagcctccaagctcatacaaattgatccaccgatccgcca 2345

                                                  
Query: 217  ca--atgatggtttgt--acaaattaattaatccaccg 250
            ||  | ||||||||||  ||||||||||| ||||||||
Sbjct: 2344 cagtaagatggtttgtacacaaattaattgatccaccg 2307



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 307  tcatatttcagagggttttcgccgaatccttaccac 342
            ||||| |||||||||||||||| |||||||||||||
Sbjct: 2278 tcatacttcagagggttttcgcggaatccttaccac 2243



to top

>gb|AC109351.3| Homo sapiens BAC clone RP11-417M17 from 4, complete sequence
          Length = 133157

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 226   tttgtacaaattaattaatcca 247
             ||||||||||||||||||||||
Sbjct: 31932 tttgtacaaattaattaatcca 31911



to top

>emb|AL356094.11| Human DNA sequence from clone RP11-64I5 on chromosome 6, complete
             sequence
          Length = 157588

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 299   tgaaataatcatatttcagag 319
             |||||||||||||||||||||
Sbjct: 11415 tgaaataatcatatttcagag 11395



to top

>gb|AC101940.17| Mus musculus chromosome 3, clone RP24-111E3, complete sequence
          Length = 157242

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 222    atggtttgtacaaattaatta 242
              |||||||||||||||||||||
Sbjct: 124403 atggtttgtacaaattaatta 124423



to top

>gb|AC158134.8| Mus musculus chromosome 3, clone RP24-384O20, complete sequence
          Length = 209278

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 222    atggtttgtacaaattaatta 242
              |||||||||||||||||||||
Sbjct: 153862 atggtttgtacaaattaatta 153842



to top

>gb|AC006369.3| Homo sapiens BAC clone RP11-278G12 from 2, complete sequence
          Length = 188359

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 301   aaataatcatatttcagagggtttt 325
             ||||||||| |||||||||||||||
Sbjct: 56941 aaataatcagatttcagagggtttt 56965



to top

>gb|AC163686.3| Mus musculus BAC clone RP23-3C10 from chromosome 6, complete sequence
          Length = 209207

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 274   tcagttccctttccttgtaa 293
             ||||||||||||||||||||
Sbjct: 52315 tcagttccctttccttgtaa 52334



to top

>gb|AC046160.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-130F23, complete
             sequence
          Length = 214627

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 274   tcagttccctttccttgtaa 293
             ||||||||||||||||||||
Sbjct: 29128 tcagttccctttccttgtaa 29109



to top

>gb|AC126929.3| Mus musculus BAC clone RP24-465A20 from chromosome 17, complete
             sequence
          Length = 168712

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 299   tgaaataatcatatttcaga 318
             ||||||||||||||||||||
Sbjct: 62673 tgaaataatcatatttcaga 62692



to top

>gb|AC149546.14| Medicago truncatula clone mth2-70o13, complete sequence
          Length = 124127

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 293   atccgatgaaataatcatatttca 316
             |||||||||||||| |||||||||
Sbjct: 66184 atccgatgaaataaccatatttca 66161



to top

>gb|AC138453.8| Medicago truncatula clone mth2-20m14, complete sequence
          Length = 144639

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 293  atccgatgaaataatcatatttca 316
            |||||||||||||| |||||||||
Sbjct: 4601 atccgatgaaataaccatatttca 4578



to top

>emb|AL022100.13|HS1059H15 Human DNA sequence from clone RP5-1059H15 on chromosome 1q25 Contains a
             dynactin 4 pseudogene and the 3' end of a novel gene,
             complete sequence
          Length = 93581

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 270   ttcatcagttccctttcctt 289
             ||||||||||||||||||||
Sbjct: 18893 ttcatcagttccctttcctt 18912



to top

>gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete sequence
          Length = 106968

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 57    agcaattgcagatgctgctg 76
             ||||||||||||||||||||
Sbjct: 72316 agcaattgcagatgctgctg 72297



to top

>gb|AC062031.7| Homo sapiens BAC clone RP11-474G7 from 2, complete sequence
          Length = 172792

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tgtacaaattaattaatcca 247
             ||||||||||||||||||||
Sbjct: 97890 tgtacaaattaattaatcca 97871



to top

>dbj|AP001666.1| Homo sapiens genomic DNA, chromosome 21q, section 10/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 298    atgaaataatcatatttcag 317
              ||||||||||||||||||||
Sbjct: 255447 atgaaataatcatatttcag 255466



to top

>gb|AC146753.1| Gallus gallus BAC clone CH261-4N19 from chromosome unknown, complete
              sequence
          Length = 231376

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 25     taaagtataaaagcaaccgttaca 48
              |||||||||||||||||| |||||
Sbjct: 126148 taaagtataaaagcaaccattaca 126171



to top

>dbj|AP001343.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2 clone:B649M24,
             LL56-APP region, complete sequence
          Length = 58286

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 298   atgaaataatcatatttcag 317
             ||||||||||||||||||||
Sbjct: 54686 atgaaataatcatatttcag 54705


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,176,405
Number of Sequences: 3902068
Number of extensions: 3176405
Number of successful extensions: 56203
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56169
Number of HSP's gapped (non-prelim): 33
length of query: 353
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 331
effective length of database: 17,147,199,772
effective search space: 5675723124532
effective search space used: 5675723124532
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top