>gb|AC116726.11| Mus musculus chromosome 10, clone RP23-285L15, complete sequence
          Length = 185427

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    tcttcagtggaagttacattt 43
             |||||||||||||||||||||
Sbjct: 97476 tcttcagtggaagttacattt 97496

>emb|AL359921.13| Human DNA sequence from clone RP11-385F5 on chromosome 1 Contains a
             novel gene, the LGALS8 gene for lectin,
             galactoside-binding, soluble, 8 (galectin 8), the gene for
             protein BAP28 (FLJ10359), a novel gene, the 5' end of the
             ACTN2 gene for actinin, alpha 2 and three CpG islands,
             complete sequence
          Length = 213757

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 365   tatacacaagaatggaatcca 385
             |||||||||||||||||||||
Sbjct: 88698 tatacacaagaatggaatcca 88718

>gb|AC166075.2| Mus musculus BAC clone RP23-143L15 from chromosome 1, complete sequence
          Length = 212447

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 223    ttcctcatttccataatcca 242
              ||||||||||||||||||||
Sbjct: 191935 ttcctcatttccataatcca 191916

>gb|AC131577.16| Mus musculus chromosome 1, clone RP23-23I4, complete sequence
          Length = 234224

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 347    tcataaccagtatgcaagta 366
              ||||||||||||||||||||
Sbjct: 108886 tcataaccagtatgcaagta 108867

>gb|DQ011584.1| Plasmodium cynomolgi Mulligan reticulocyte binding protein 2 gene,
            complete cds
          Length = 9775

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   taaacaaaatagaaaggttg 102
            ||||||||||||||||||||
Sbjct: 8020 taaacaaaatagaaaggttg 8039

>gb|AC137555.4| Mus musculus BAC clone RP23-445B17 from 1, complete sequence
          Length = 174607

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 223   ttcctcatttccataatcca 242
             ||||||||||||||||||||
Sbjct: 62360 ttcctcatttccataatcca 62341

>gb|AC087229.27| Mus musculus strain C57BL/6J chromosome 1 clone rp23-191a19, complete
              sequence
          Length = 215043

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    taccggaggctgagaaaaga 215
              ||||||||||||||||||||
Sbjct: 171721 taccggaggctgagaaaaga 171740


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,192,891
Number of Sequences: 3902068
Number of extensions: 4192891
Number of successful extensions: 72759
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72746
Number of HSP's gapped (non-prelim): 13
length of query: 393
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 371
effective length of database: 17,147,199,772
effective search space: 6361611115412
effective search space used: 6361611115412
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)