ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl43c10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome... 42 0.61
2gb|AC102136.6| Mus musculus chromosome 3, clone RP23-269G19, com... 40 2.4
3gb|AC147238.3| Mus musculus BAC clone RP23-377L7 from chromosome... 40 2.4
4gb|AC158583.3| Mus musculus chromosome 3, clone RP24-318B11, com... 40 2.4
5ref|XM_386173.1| Gibberella zeae PH-1 chromosome 3 conserved hyp... 40 2.4
6gb|AC123035.2| Mus musculus BAC clone RP24-497E22 from 10, compl... 40 2.4
7emb|BX294135.1| Pirellula sp. strain 1 complete genome; segment ... 40 2.4
8gb|AC186551.1| Pan troglodytes chromosome 7 clone CH251-720G4, c... 38 9.6
9ref|NM_011775.4| Mus musculus zona pellucida glycoprotein 2 (Zp2... 38 9.6
10gb|AC107681.15| Mus musculus chromosome 12, clone RP23-380M24, c... 38 9.6
11gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome... 38 9.6
12gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosom... 38 9.6
13gb|AC121890.3| Mus musculus BAC clone RP24-146K18 from chromosom... 38 9.6
14gb|AC122853.3| Mus musculus BAC clone RP23-175F18 from 7, comple... 38 9.6
15gb|AC010719.4| Homo sapiens BAC clone CTD-2227E11 from 7, comple... 38 9.6
16gb|AC113106.9| Mus musculus chromosome 9, clone RP23-325C1, comp... 38 9.6
17gb|AC166057.2| Mus musculus BAC clone RP23-385D11 from chromosom... 38 9.6
18gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome... 38 9.6
19emb|AL365207.17| Human DNA sequence from clone RP11-420O24 on ch... 38 9.6
20emb|AL359973.11| Human DNA sequence from clone RP11-10B2 on chro... 38 9.6
21emb|AL133227.15| Human DNA sequence from clone RP11-394O2 on chr... 38 9.6
22emb|AL049646.19|HSDJ568F9 Human DNA sequence from clone RP4-568F... 38 9.6
23gb|AC164636.4| Mus musculus BAC clone RP23-70P16 from chromosome... 38 9.6
24emb|AL596215.7| Mouse DNA sequence from clone RP23-278I21 on chr... 38 9.6
25emb|AJ320506.1|MMU320506 Mus musculus Dlk1 gene for delta-like a... 38 9.6
26gb|AC154795.2| Mus musculus BAC clone RP24-486D21 from chromosom... 38 9.6
27dbj|AK138699.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 38 9.6
28dbj|AK135903.1| Mus musculus in vitro fertilized eggs cDNA, RIKE... 38 9.6
29gb|AC096627.28| Mus musculus strain C57BL/6J clone rp23-77b23 ma... 38 9.6
30gb|AC157279.2| Mus musculus BAC clone RP23-149H21 from chromosom... 38 9.6
31gb|AC151052.4| Mus musculus BAC clone RP24-72K12 from chromosome... 38 9.6
32gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome... 38 9.6
33gb|AC167420.1| Mus musculus BAC clone RP23-239F23 from chromosom... 38 9.6
34gb|BC071183.1| Mus musculus zona pellucida glycoprotein 2, mRNA ... 38 9.6
35ref|NM_031150.1| Rattus norvegicus zona pellucida glycoprotein 2... 38 9.6
36gb|AC074042.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 38 9.6
37emb|AL808132.5| Mouse DNA sequence from clone RP23-125A12 on chr... 38 9.6
38gb|AC165954.3| Mus musculus BAC clone RP23-450F5 from chromosome... 38 9.6
39gb|M34148.1|MUSZP2A Mouse zona pellucida sperm-binding protein Z... 38 9.6
40dbj|AB000929.1| Rattus norvegicus mRNA for zona pellucida 2 glyc... 38 9.6
41dbj|AB047760.1| Mus musculus gene for dlk (Delta like), complete... 38 9.6
42emb|AL611950.17| Mouse DNA sequence from clone RP23-45A18 on chr... 38 9.6 
>gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome 9, complete sequence
          Length = 221907

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 13    gataaatagagcagtgttaca 33
             |||||||||||||||||||||
Sbjct: 51658 gataaatagagcagtgttaca 51638
to top
>gb|AC102136.6| Mus musculus chromosome 3, clone RP23-269G19, complete sequence
          Length = 186659

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    ggggtggggggagaggcaaa 87
             ||||||||||||||||||||
Sbjct: 82867 ggggtggggggagaggcaaa 82848
to top
>gb|AC147238.3| Mus musculus BAC clone RP23-377L7 from chromosome 10, complete sequence
          Length = 176876

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    ggggtggggggagaggcaaa 87
             ||||||||||||||||||||
Sbjct: 73980 ggggtggggggagaggcaaa 73961
to top
>gb|AC158583.3| Mus musculus chromosome 3, clone RP24-318B11, complete sequence
          Length = 168986

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     ggggtggggggagaggcaaa 87
              ||||||||||||||||||||
Sbjct: 100791 ggggtggggggagaggcaaa 100772
to top
>ref|XM_386173.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
            (FG05997.1) partial mRNA
          Length = 1551

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 142  agggcctcctcaagcaggtcctcc 165
            ||||| ||||||||||||||||||
Sbjct: 1274 agggcgtcctcaagcaggtcctcc 1297
to top
>gb|AC123035.2| Mus musculus BAC clone RP24-497E22 from 10, complete sequence
          Length = 166009

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    ggggtggggggagaggcaaa 87
             ||||||||||||||||||||
Sbjct: 54580 ggggtggggggagaggcaaa 54561
to top
>emb|BX294135.1| Pirellula sp. strain 1 complete genome; segment 3/24
          Length = 340750

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 163    tccaaaagcaccgaacaaac 182
              ||||||||||||||||||||
Sbjct: 278204 tccaaaagcaccgaacaaac 278185
to top
>gb|AC186551.1| Pan troglodytes chromosome 7 clone CH251-720G4, complete sequence
          Length = 173362

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    aacagaaacactaggggtg 73
             |||||||||||||||||||
Sbjct: 53882 aacagaaacactaggggtg 53900
to top
>ref|NM_011775.4| Mus musculus zona pellucida glycoprotein 2 (Zp2), mRNA
          Length = 2201

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  ggcggaggtacctcactag 120
            |||||||||||||||||||
Sbjct: 1573 ggcggaggtacctcactag 1555
to top
>gb|AC107681.15| Mus musculus chromosome 12, clone RP23-380M24, complete sequence
          Length = 186496

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     ggggtggggggagaggcaa 86
              |||||||||||||||||||
Sbjct: 105595 ggggtggggggagaggcaa 105613
to top
>gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome 9, complete sequence
          Length = 175945

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 67    aggggtggggggagaggcaaaat 89
             ||||||| |||||||||||||||
Sbjct: 67375 aggggtgaggggagaggcaaaat 67397
to top
>gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosome 16, complete
            sequence
          Length = 163943

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 68   ggggtggggggagaggcaa 86
            |||||||||||||||||||
Sbjct: 8726 ggggtggggggagaggcaa 8744
to top
>gb|AC121890.3| Mus musculus BAC clone RP24-146K18 from chromosome 16, complete
             sequence
          Length = 136955

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 68    ggggtggggggagaggcaa 86
             |||||||||||||||||||
Sbjct: 38561 ggggtggggggagaggcaa 38543
to top
>gb|AC122853.3| Mus musculus BAC clone RP23-175F18 from 7, complete sequence
          Length = 199264

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 102    ggcggaggtacctcactag 120
              |||||||||||||||||||
Sbjct: 151701 ggcggaggtacctcactag 151719
to top
>gb|AC010719.4| Homo sapiens BAC clone CTD-2227E11 from 7, complete sequence
          Length = 140545

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 65     ctaggggtggggggagagg 83
              |||||||||||||||||||
Sbjct: 130590 ctaggggtggggggagagg 130572
to top
>gb|AC113106.9| Mus musculus chromosome 9, clone RP23-325C1, complete sequence
          Length = 191609

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 67     aggggtggggggagaggcaaaat 89
              ||||||| |||||||||||||||
Sbjct: 141784 aggggtgaggggagaggcaaaat 141806
to top
>gb|AC166057.2| Mus musculus BAC clone RP23-385D11 from chromosome 14, complete
             sequence
          Length = 198165

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    cactaggggtggggggaga 81
             |||||||||||||||||||
Sbjct: 14138 cactaggggtggggggaga 14120
to top
>gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome 6, complete sequence
          Length = 212166

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 68     ggggtggggggagaggcaa 86
              |||||||||||||||||||
Sbjct: 166703 ggggtggggggagaggcaa 166685
to top
>emb|AL365207.17| Human DNA sequence from clone RP11-420O24 on chromosome 1 Contains a CpG
              island, complete sequence
          Length = 182679

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 145    gcctcctcaagcaggtcct 163
              |||||||||||||||||||
Sbjct: 158285 gcctcctcaagcaggtcct 158267
to top
>emb|AL359973.11| Human DNA sequence from clone RP11-10B2 on chromosome Xq24-26.1
             Contains a prostaglandin-endoperoxide synthase 1
             (prostaglandin G/H synthase and cyclooxygenase) (PTGS1)
             pseudogene, the gene for a novel protein similar to part
             of NADH dehydrogenase 4L (MTND4L) and a pseudogene similar
             to part of NADH dehydrogenase 4 (MTND4), complete sequence
          Length = 109699

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 145   gcctcctcaagcaggtcct 163
             |||||||||||||||||||
Sbjct: 89329 gcctcctcaagcaggtcct 89347
to top
>emb|AL133227.15| Human DNA sequence from clone RP11-394O2 on chromosome 20 Contains the
             OVCOV1 gene for ovarian cancer overexpressed 1, the 3' end
             of the ELMO2 gene for engulfment and cell motility 2
             (ced-12 homolog, C. elegans) and a CpG island, complete
             sequence
          Length = 85566

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 76    gggagaggcaaaatcaata 94
             |||||||||||||||||||
Sbjct: 75328 gggagaggcaaaatcaata 75310
to top
>emb|AL049646.19|HSDJ568F9 Human DNA sequence from clone RP4-568F9 on chromosome 20 Contains the
             ZNF133 gene for zinc finger protein 133, three novel
             genes, the 3' end of the C20orf12 gene for chromosome 20
             open reading frame 12 and two CpG islands, complete
             sequence
          Length = 155432

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 145   gcctcctcaagcaggtcct 163
             |||||||||||||||||||
Sbjct: 90117 gcctcctcaagcaggtcct 90135
to top
>gb|AC164636.4| Mus musculus BAC clone RP23-70P16 from chromosome 6, complete sequence
          Length = 212096

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     ggggtggggggagaggcaa 86
              |||||||||||||||||||
Sbjct: 195951 ggggtggggggagaggcaa 195969
to top
>emb|AL596215.7| Mouse DNA sequence from clone RP23-278I21 on chromosome 11, complete
             sequence
          Length = 203117

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    agagcagtgttacagcagc 38
             |||||||||||||||||||
Sbjct: 19654 agagcagtgttacagcagc 19636
to top
>emb|AJ320506.1|MMU320506 Mus musculus Dlk1 gene for delta-like and Gtl2 gene
          Length = 111805

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 68    ggggtggggggagaggcaa 86
             |||||||||||||||||||
Sbjct: 11312 ggggtggggggagaggcaa 11294
to top
>gb|AC154795.2| Mus musculus BAC clone RP24-486D21 from chromosome 14, complete
             sequence
          Length = 153985

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    cactaggggtggggggaga 81
             |||||||||||||||||||
Sbjct: 12147 cactaggggtggggggaga 12165
to top
>dbj|AK138699.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A430016G17 product:zona pellucida
            glycoprotein 2, full insert sequence
          Length = 2395

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  ggcggaggtacctcactag 120
            |||||||||||||||||||
Sbjct: 1759 ggcggaggtacctcactag 1741
to top
>dbj|AK135903.1| Mus musculus in vitro fertilized eggs cDNA, RIKEN full-length
            enriched library, clone:7420435F10 product:zona pellucida
            glycoprotein 2, full insert sequence
          Length = 2234

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  ggcggaggtacctcactag 120
            |||||||||||||||||||
Sbjct: 1573 ggcggaggtacctcactag 1555
to top
>gb|AC096627.28| Mus musculus strain C57BL/6J clone rp23-77b23 map 11, complete sequence
          Length = 264908

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 20    agagcagtgttacagcagc 38
             |||||||||||||||||||
Sbjct: 57043 agagcagtgttacagcagc 57061
to top
>gb|AC157279.2| Mus musculus BAC clone RP23-149H21 from chromosome 13, complete
             sequence
          Length = 187493

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 66    taggggtggggggagaggc 84
             |||||||||||||||||||
Sbjct: 67553 taggggtggggggagaggc 67535
to top
>gb|AC151052.4| Mus musculus BAC clone RP24-72K12 from chromosome 7, complete sequence
          Length = 216989

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 102   ggcggaggtacctcactag 120
             |||||||||||||||||||
Sbjct: 92780 ggcggaggtacctcactag 92762
to top
>gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome 12, complete sequence
          Length = 159497

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 67     aggggtggggggagaggca 85
              |||||||||||||||||||
Sbjct: 103330 aggggtggggggagaggca 103348
to top
>gb|AC167420.1| Mus musculus BAC clone RP23-239F23 from chromosome 12, complete
             sequence
          Length = 185684

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 67    aggggtggggggagaggca 85
             |||||||||||||||||||
Sbjct: 42125 aggggtggggggagaggca 42143
to top
>gb|BC071183.1| Mus musculus zona pellucida glycoprotein 2, mRNA (cDNA clone
            MGC:76483 IMAGE:30473497), complete cds
          Length = 2198

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  ggcggaggtacctcactag 120
            |||||||||||||||||||
Sbjct: 1555 ggcggaggtacctcactag 1537
to top
>ref|NM_031150.1| Rattus norvegicus zona pellucida glycoprotein 2 (Zp2), mRNA
          Length = 2138

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  ggcggaggtacctcactag 120
            |||||||||||||||||||
Sbjct: 1529 ggcggaggtacctcactag 1511
to top
>gb|AC074042.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-99G18, complete
             sequence
          Length = 226048

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    agaaacactaggggtgggg 76
             |||||||||||||||||||
Sbjct: 36711 agaaacactaggggtgggg 36693
to top
>emb|AL808132.5| Mouse DNA sequence from clone RP23-125A12 on chromosome X, complete
              sequence
          Length = 201114

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 14     ataaatagagcagtgttacagca 36
              ||||||||| |||||||||||||
Sbjct: 168382 ataaatagaacagtgttacagca 168360
to top
>gb|AC165954.3| Mus musculus BAC clone RP23-450F5 from chromosome 12, complete sequence
          Length = 184826

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    ggggtggggggagaggcaa 86
             |||||||||||||||||||
Sbjct: 25627 ggggtggggggagaggcaa 25645
to top
>gb|M34148.1|MUSZP2A Mouse zona pellucida sperm-binding protein ZP2 mRNA, complete cds,
            clones pZP2.-(2,3,4)
          Length = 2201

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  ggcggaggtacctcactag 120
            |||||||||||||||||||
Sbjct: 1573 ggcggaggtacctcactag 1555
to top
>dbj|AB000929.1| Rattus norvegicus mRNA for zona pellucida 2 glycoprotein, complete
            cds
          Length = 2138

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  ggcggaggtacctcactag 120
            |||||||||||||||||||
Sbjct: 1529 ggcggaggtacctcactag 1511
to top
>dbj|AB047760.1| Mus musculus gene for dlk (Delta like), complete cds
          Length = 8355

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 68   ggggtggggggagaggcaa 86
            |||||||||||||||||||
Sbjct: 5757 ggggtggggggagaggcaa 5739
to top
>emb|AL611950.17| Mouse DNA sequence from clone RP23-45A18 on chromosome 4, complete
             sequence
          Length = 161331

 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    ggggtggggggagaggcaa 86
             |||||||||||||||||||
Sbjct: 51245 ggggtggggggagaggcaa 51263


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,411,289
Number of Sequences: 3902068
Number of extensions: 1411289
Number of successful extensions: 114364
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 114258
Number of HSP's gapped (non-prelim): 106
length of query: 193
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 171
effective length of database: 17,147,199,772
effective search space: 2932171161012
effective search space used: 2932171161012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top