ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl43b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK067082.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 80 6e-12
3dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic D... 80 6e-12
4dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic D... 80 6e-12
5gb|AY108559.1| Zea mays PCO061836 mRNA sequence 72 1e-09
6gb|AC116646.5| Homo sapiens BAC clone RP11-714J18 from 4, comple... 42 1.3
7gb|AC108935.5| Homo sapiens BAC clone RP11-503L19 from 4, comple... 42 1.3
8gb|AY253318.1| HIV-1 isolate 01TZA306 from Tanzania gag protein ... 40 5.0
9emb|AL162742.9| Human DNA sequence from clone RP11-127L20 on chr... 40 5.0
10gb|AY463223.1| HIV-1 isolate C.ZA.J54Ma from South Africa, compl... 40 5.0
11gb|AF303399.1| Brachypodium distachyon internal transcribed spac... 40 5.0
12dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 40 5.0
13gb|DQ011177.1| HIV-1 isolate 04ZASK136B1 from South Africa, comp... 40 5.0
14gb|DQ011166.1| HIV-1 isolate 04ZASK135B1 from South Africa, comp... 40 5.0
15emb|AL773508.6| Mouse DNA sequence from clone RP23-253D15 on chr... 40 5.0
16gb|AY713414.1| HIV-1 isolate 94IN_20635-4 from India gag protein... 40 5.0
17gb|AC079436.2| Rattus norvegicus strain Brown Norway chromosome ... 40 5.0
18gb|DQ351226.1| HIV-1 isolate 03ZAPS025MB1 from South Africa, com... 40 5.0
19gb|L11578.1|BRH58SITS Brachypodium distachyon 5.8S ribosomal RNA... 40 5.0

>dbj|AK067082.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013096E12, full
            insert sequence
          Length = 3335

 Score =  145 bits (73), Expect = 1e-31
 Identities = 136/157 (86%)
 Strand = Plus / Minus

                                                                        
Query: 219  ccagggaacgacctcccactgcttgtgacgagctccttgatggtcgcttggatgtccttg 278
            ||||| || ||||||||||| |||||||| || ||||||||||| |||||||||||||| 
Sbjct: 3022 ccaggaaatgacctcccactacttgtgacaagttccttgatggttgcttggatgtcctta 2963

                                                                        
Query: 279  tcctccagcatggactccagtggcacatgtaggcggaatctccagtaatgcttcgggtta 338
            || |||| ||  || |||| || ||||||||| ||||||||||| |||||||||||||||
Sbjct: 2962 tcgtccaacagcgaatccaatgtcacatgtagccggaatctccaataatgcttcgggtta 2903

                                                 
Query: 339  gtggggtcgttgattgtttcctccgctgctggtcttg 375
            || ||||| ||||||||||||||   |||||||||||
Sbjct: 2902 gttgggtcattgattgtttcctcttttgctggtcttg 2866



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                            
Query: 312      cggaatctccagtaatgcttcgggttagtggggtcgttgattgtttcctccgctgctggt 371
                ||||||||||| ||||||||||||||||| ||||| ||||||||||||||   |||||||
Sbjct: 27913498 cggaatctccaataatgcttcgggttagttgggtcattgattgtttcctcttttgctggt 27913439

                    
Query: 372      cttg 375
                ||||
Sbjct: 27913438 cttg 27913435



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                            
Query: 219      ccagggaacgacctcccactgcttgtgacgagctccttgatggtcgcttggatgtccttg 278
                ||||| || ||||||||||| |||||||| || ||||||||||| |||||||||||||| 
Sbjct: 27914125 ccaggaaatgacctcccactacttgtgacaagttccttgatggttgcttggatgtcctta 27914066

                                                
Query: 279      tcctccagcatggactccagtggcacatgtag 310
                || |||| ||  || |||| || |||||||||
Sbjct: 27914065 tcgtccaacagcgaatccaatgtcacatgtag 27914034



to top

>dbj|AP005452.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E03
          Length = 159980

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                         
Query: 312   cggaatctccagtaatgcttcgggttagtggggtcgttgattgtttcctccgctgctggt 371
             ||||||||||| ||||||||||||||||| ||||| ||||||||||||||   |||||||
Sbjct: 76856 cggaatctccaataatgcttcgggttagttgggtcattgattgtttcctcttttgctggt 76797

                 
Query: 372   cttg 375
             ||||
Sbjct: 76796 cttg 76793



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                         
Query: 219   ccagggaacgacctcccactgcttgtgacgagctccttgatggtcgcttggatgtccttg 278
             ||||| || ||||||||||| |||||||| || ||||||||||| |||||||||||||| 
Sbjct: 77483 ccaggaaatgacctcccactacttgtgacaagttccttgatggttgcttggatgtcctta 77424

                                             
Query: 279   tcctccagcatggactccagtggcacatgtag 310
             || |||| ||  || |||| || |||||||||
Sbjct: 77423 tcgtccaacagcgaatccaatgtcacatgtag 77392



to top

>dbj|AP003825.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OJ1343_D04
          Length = 143407

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                        
Query: 312  cggaatctccagtaatgcttcgggttagtggggtcgttgattgtttcctccgctgctggt 371
            ||||||||||| ||||||||||||||||| ||||| ||||||||||||||   |||||||
Sbjct: 2832 cggaatctccaataatgcttcgggttagttgggtcattgattgtttcctcttttgctggt 2773

                
Query: 372  cttg 375
            ||||
Sbjct: 2772 cttg 2769



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 219  ccagggaacgacctcccactgcttgtgacgagctccttgatggtcgcttggatgtccttg 278
            ||||| || ||||||||||| |||||||| || ||||||||||| |||||||||||||| 
Sbjct: 3459 ccaggaaatgacctcccactacttgtgacaagttccttgatggttgcttggatgtcctta 3400

                                            
Query: 279  tcctccagcatggactccagtggcacatgtag 310
            || |||| ||  || |||| || |||||||||
Sbjct: 3399 tcgtccaacagcgaatccaatgtcacatgtag 3368



to top

>gb|AY108559.1| Zea mays PCO061836 mRNA sequence
          Length = 710

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Minus

                                                                       
Query: 312 cggaatctccagtaatgcttcgggttagtggggtcgttgattgtttcctccgctgctggt 371
           ||||||||||| || ||||| |||||||||||||| |||||||||||||| |  ||||||
Sbjct: 694 cggaatctccaatagtgctttgggttagtggggtcattgattgtttcctctggcgctggt 635

               
Query: 372 cttg 375
           ||||
Sbjct: 634 cttg 631



to top

>gb|AC116646.5| Homo sapiens BAC clone RP11-714J18 from 4, complete sequence
          Length = 49367

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 152   gttctttggggtcctttgttgttcc 176
             ||||||||||||||||||| |||||
Sbjct: 48924 gttctttggggtcctttgtggttcc 48900



to top

>gb|AC108935.5| Homo sapiens BAC clone RP11-503L19 from 4, complete sequence
          Length = 133531

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 152  gttctttggggtcctttgttgttcc 176
            ||||||||||||||||||| |||||
Sbjct: 1557 gttctttggggtcctttgtggttcc 1533



to top

>gb|AY253318.1| HIV-1 isolate 01TZA306 from Tanzania gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8737

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   tttctctagctgaaacaaca 53
            ||||||||||||||||||||
Sbjct: 3127 tttctctagctgaaacaaca 3146



to top

>emb|AL162742.9| Human DNA sequence from clone RP11-127L20 on chromosome 10 Contains the
              gene for a novel glutathione-S-transferase gene(LOC119391),
              a novel gene (KIAA1754), the 5'end of a novel gene
              (FLJ35908), two novel genes and two CpG islands, complete
              sequence
          Length = 178428

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    agcatggactccagtggcac 304
              ||||||||||||||||||||
Sbjct: 143443 agcatggactccagtggcac 143462



to top

>gb|AY463223.1| HIV-1 isolate C.ZA.J54Ma from South Africa, complete genome
          Length = 9117

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 26   aaagattttttctctagctgaaacaaca 53
            ||||||| |||||||| |||||||||||
Sbjct: 3366 aaagattgtttctctaactgaaacaaca 3393



to top

>gb|AF303399.1| Brachypodium distachyon internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence
          Length = 602

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 150 ccgttctttggggtcctttg 169
           ||||||||||||||||||||
Sbjct: 583 ccgttctttggggtcctttg 564



to top

>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 279    tcctccagcatggactccag 298
              ||||||||||||||||||||
Sbjct: 679534 tcctccagcatggactccag 679553



to top

>gb|DQ011177.1| HIV-1 isolate 04ZASK136B1 from South Africa, complete genome
          Length = 9042

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   tttctctagctgaaacaaca 53
            ||||||||||||||||||||
Sbjct: 3367 tttctctagctgaaacaaca 3386



to top

>gb|DQ011166.1| HIV-1 isolate 04ZASK135B1 from South Africa, complete genome
          Length = 9073

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 34   tttctctagctgaaacaaca 53
            ||||||||||||||||||||
Sbjct: 3340 tttctctagctgaaacaaca 3359



to top

>emb|AL773508.6| Mouse DNA sequence from clone RP23-253D15 on chromosome 2, complete
             sequence
          Length = 132091

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 100   tatctccctctcttcttctc 119
             ||||||||||||||||||||
Sbjct: 44695 tatctccctctcttcttctc 44676



to top

>gb|AY713414.1| HIV-1 isolate 94IN_20635-4 from India gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8745

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 26   aaagattttttctctagctgaaacaaca 53
            ||||||| |||||||| |||||||||||
Sbjct: 3119 aaagattgtttctctaactgaaacaaca 3146



to top

>gb|AC079436.2| Rattus norvegicus strain Brown Norway chromosome 4 clone RP31-108L19,
             complete sequence
          Length = 174622

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    atatctccctctcttcttct 118
             ||||||||||||||||||||
Sbjct: 72144 atatctccctctcttcttct 72163



to top

>gb|DQ351226.1| HIV-1 isolate 03ZAPS025MB1 from South Africa, complete genome
          Length = 9081

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 26   aaagattttttctctagctgaaacaaca 53
            ||||||| |||||||| |||||||||||
Sbjct: 3352 aaagattgtttctctaactgaaacaaca 3379



to top

>gb|L11578.1|BRH58SITS Brachypodium distachyon 5.8S ribosomal RNA gene
          Length = 602

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 150 ccgttctttggggtcctttg 169
           ||||||||||||||||||||
Sbjct: 583 ccgttctttggggtcctttg 564


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,276,599
Number of Sequences: 3902068
Number of extensions: 3276599
Number of successful extensions: 57044
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56993
Number of HSP's gapped (non-prelim): 51
length of query: 375
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 353
effective length of database: 17,147,199,772
effective search space: 6052961519516
effective search space used: 6052961519516
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top