Clone Name | rbastl43a05 |
---|---|
Clone Library Name | barley_pub |
>gb|AC129574.8| Mus musculus chromosome 16, clone RP23-78C2, complete sequence Length = 214649 Score = 46.1 bits (23), Expect = 0.10 Identities = 23/23 (100%) Strand = Plus / Plus Query: 125 ttcacaacaaacatacatctgaa 147 ||||||||||||||||||||||| Sbjct: 122106 ttcacaacaaacatacatctgaa 122128
>gb|AC113957.8| Mus musculus chromosome 15, clone RP23-452M1, complete sequence Length = 168824 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 232 acagaaaacacaattcttgg 251 |||||||||||||||||||| Sbjct: 6550 acagaaaacacaattcttgg 6569
>gb|AC146155.3| Pan troglodytes BAC clone RP43-37F3 from 7, complete sequence Length = 159409 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 388 caggtggttctccttctccatggc 411 ||||||||||| |||||||||||| Sbjct: 83688 caggtggttctgcttctccatggc 83665
>gb|AC005251.1| Homo sapiens BAC clone CTA-324D18 from 7, complete sequence Length = 92636 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 388 caggtggttctccttctccatggc 411 ||||||||||| |||||||||||| Sbjct: 42696 caggtggttctgcttctccatggc 42719
>gb|AC110919.10| Mus musculus chromosome 15, clone RP23-216B8, complete sequence Length = 228930 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 acagaaaacacaattcttgg 251 |||||||||||||||||||| Sbjct: 43676 acagaaaacacaattcttgg 43657
>emb|X62073.1|ECKDG Erwinia chrysanthemi kdgF, kduI, kduD, pelW genes Length = 4454 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 106 gccagccagcaaaactggct 125 |||||||||||||||||||| Sbjct: 2988 gccagccagcaaaactggct 3007
>ref|XM_779219.1| PREDICTED: Strongylocentrotus purpuratus similar to mitochondrial ATP synthase gamma-subunit (LOC579085), mRNA Length = 864 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtggttctccttctccatgg 410 |||||||||||||||||||| Sbjct: 243 gtggttctccttctccatgg 224
>ref|XR_000627.1| PREDICTED: Homo sapiens similar to ribosomal protein L23 (LOC222901), misc RNA Length = 633 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 388 caggtggttctccttctccatggc 411 ||||||||||| |||||||||||| Sbjct: 302 caggtggttctgcttctccatggc 325
>ref|XR_000616.1| PREDICTED: Homo sapiens similar to ribosomal protein L23 (LOC222901), misc RNA Length = 633 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 388 caggtggttctccttctccatggc 411 ||||||||||| |||||||||||| Sbjct: 302 caggtggttctgcttctccatggc 325
>ref|XR_000588.1| PREDICTED: Homo sapiens similar to ribosomal protein L23 (LOC222901), misc RNA Length = 633 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 388 caggtggttctccttctccatggc 411 ||||||||||| |||||||||||| Sbjct: 302 caggtggttctgcttctccatggc 325
>gb|AY261521.1| Influenza A virus (A/turkey/Ontario/HR2/2000(H7N1)) neuraminidase (NA) gene, partial cds Length = 1405 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 cagagaaactgttatctgtc 79 |||||||||||||||||||| Sbjct: 1187 cagagaaactgttatctgtc 1168
>gb|CY004422.1| Influenza A virus (A/laughing gull/DE/5/2003(H9N1)) segment 6, complete sequence Length = 1458 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 cagagaaactgttatctgtc 79 |||||||||||||||||||| Sbjct: 1185 cagagaaactgttatctgtc 1166
>gb|AY244650.1| Tetratrichomonas prowazeki strain SL small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence Length = 445 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 aaaaaactaaactagttctt 28 |||||||||||||||||||| Sbjct: 114 aaaaaactaaactagttctt 95
>emb|AL929142.6| Mouse DNA sequence from clone RP23-340A13 on chromosome 2, complete sequence Length = 207823 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 9 aaaaaactaaactagttcttccca 32 ||||||||||| |||||||||||| Sbjct: 43446 aaaaaactaaagtagttcttccca 43469 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,124,244 Number of Sequences: 3902068 Number of extensions: 4124244 Number of successful extensions: 78551 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 78529 Number of HSP's gapped (non-prelim): 22 length of query: 464 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 442 effective length of database: 17,147,199,772 effective search space: 7579062299224 effective search space used: 7579062299224 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)