>gb|AC129574.8| Mus musculus chromosome 16, clone RP23-78C2, complete sequence
          Length = 214649

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 125    ttcacaacaaacatacatctgaa 147
              |||||||||||||||||||||||
Sbjct: 122106 ttcacaacaaacatacatctgaa 122128

>gb|AC113957.8| Mus musculus chromosome 15, clone RP23-452M1, complete sequence
          Length = 168824

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 232  acagaaaacacaattcttgg 251
            ||||||||||||||||||||
Sbjct: 6550 acagaaaacacaattcttgg 6569

>gb|AC146155.3| Pan troglodytes BAC clone RP43-37F3 from 7, complete sequence
          Length = 159409

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 388   caggtggttctccttctccatggc 411
             ||||||||||| ||||||||||||
Sbjct: 83688 caggtggttctgcttctccatggc 83665

>gb|AC005251.1| Homo sapiens BAC clone CTA-324D18 from 7, complete sequence
          Length = 92636

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 388   caggtggttctccttctccatggc 411
             ||||||||||| ||||||||||||
Sbjct: 42696 caggtggttctgcttctccatggc 42719

>gb|AC110919.10| Mus musculus chromosome 15, clone RP23-216B8, complete sequence
          Length = 228930

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   acagaaaacacaattcttgg 251
             ||||||||||||||||||||
Sbjct: 43676 acagaaaacacaattcttgg 43657

>emb|X62073.1|ECKDG Erwinia chrysanthemi kdgF, kduI, kduD, pelW genes
          Length = 4454

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 106  gccagccagcaaaactggct 125
            ||||||||||||||||||||
Sbjct: 2988 gccagccagcaaaactggct 3007

>ref|XM_779219.1| PREDICTED: Strongylocentrotus purpuratus similar to mitochondrial
           ATP synthase gamma-subunit (LOC579085), mRNA
          Length = 864

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 391 gtggttctccttctccatgg 410
           ||||||||||||||||||||
Sbjct: 243 gtggttctccttctccatgg 224

>ref|XR_000627.1| PREDICTED: Homo sapiens similar to ribosomal protein L23
           (LOC222901), misc RNA
          Length = 633

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 388 caggtggttctccttctccatggc 411
           ||||||||||| ||||||||||||
Sbjct: 302 caggtggttctgcttctccatggc 325

>ref|XR_000616.1| PREDICTED: Homo sapiens similar to ribosomal protein L23
           (LOC222901), misc RNA
          Length = 633

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 388 caggtggttctccttctccatggc 411
           ||||||||||| ||||||||||||
Sbjct: 302 caggtggttctgcttctccatggc 325

>ref|XR_000588.1| PREDICTED: Homo sapiens similar to ribosomal protein L23
           (LOC222901), misc RNA
          Length = 633

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 388 caggtggttctccttctccatggc 411
           ||||||||||| ||||||||||||
Sbjct: 302 caggtggttctgcttctccatggc 325

>gb|AY261521.1| Influenza A virus (A/turkey/Ontario/HR2/2000(H7N1)) neuraminidase
            (NA) gene, partial cds
          Length = 1405

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 60   cagagaaactgttatctgtc 79
            ||||||||||||||||||||
Sbjct: 1187 cagagaaactgttatctgtc 1168

>gb|CY004422.1| Influenza A virus (A/laughing gull/DE/5/2003(H9N1)) segment 6,
            complete sequence
          Length = 1458

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 60   cagagaaactgttatctgtc 79
            ||||||||||||||||||||
Sbjct: 1185 cagagaaactgttatctgtc 1166

>gb|AY244650.1| Tetratrichomonas prowazeki strain SL small subunit ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene and internal transcribed spacer
           2, complete sequence; and large subunit ribosomal RNA
           gene, partial sequence
          Length = 445

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 9   aaaaaactaaactagttctt 28
           ||||||||||||||||||||
Sbjct: 114 aaaaaactaaactagttctt 95

>emb|AL929142.6| Mouse DNA sequence from clone RP23-340A13 on chromosome 2, complete
             sequence
          Length = 207823

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 9     aaaaaactaaactagttcttccca 32
             ||||||||||| ||||||||||||
Sbjct: 43446 aaaaaactaaagtagttcttccca 43469


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,124,244
Number of Sequences: 3902068
Number of extensions: 4124244
Number of successful extensions: 78551
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78529
Number of HSP's gapped (non-prelim): 22
length of query: 464
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 442
effective length of database: 17,147,199,772
effective search space: 7579062299224
effective search space used: 7579062299224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)