ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl42h05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_467537.1| Oryza sativa (japonica cultivar-group), mRNA 56 1e-04
2gb|BT019017.1| Zea mays clone Contig515.F mRNA sequence 56 1e-04
3dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
4dbj|AP005113.3| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
5dbj|AP005052.3| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
6dbj|AK122035.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
7dbj|AK061221.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
8gb|AY109484.1| Zea mays CL3541_1 mRNA sequence 56 1e-04
9emb|AL445564.1|MPULM02 Mycoplasma pulmonis (strain UAB CTIP) com... 42 1.5
10emb|AL645683.7| Mouse DNA sequence from clone RP23-374M7 on chro... 42 1.5
11emb|AL772408.4| Mouse DNA sequence from clone RP23-339B20 on chr... 42 1.5
12gb|AC099468.9| Rattus norvegicus 1 BAC CH230-37P5 (Children's Ho... 40 6.0
13gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map... 40 6.0
14emb|AL590364.5| Human DNA sequence from clone RP11-342D14 on chr... 40 6.0
15emb|AL138920.11| Human DNA sequence from clone RP11-148B2 on chr... 40 6.0
16emb|AL135918.6| Human DNA sequence from clone RP1-89K8 on chromo... 40 6.0
17emb|BX664015.1| Serratia marcescens plasmid R478 40 6.0
18gb|AC119409.25| Medicago truncatula clone mth2-10i9, complete se... 40 6.0
19dbj|AK057337.1| Homo sapiens cDNA FLJ32775 fis, clone TESTI2002012 40 6.0
20ref|XM_944060.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 6.0
21ref|XM_378546.2| PREDICTED: Homo sapiens hypothetical protein LO... 40 6.0
22gb|AC008958.7| Homo sapiens chromosome 5 clone CTD-2353N24, comp... 40 6.0
23dbj|AP002008.5| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 6.0
24emb|AL591596.5| Zebrafish DNA sequence from clone XX-205M23, com... 40 6.0

>ref|XM_467537.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4486

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 321  tagaaccacttgtagctaagcagaactgagttgatgacatgcatgagcaagcggagattg 380
            ||||| |||||||||||||||||||| || || || ||||||||||  |||||||   ||
Sbjct: 4127 tagaatcacttgtagctaagcagaacagaattaattacatgcatgaataagcggatgctg 4068

                                            
Query: 381  ctgttatccaatgggctggtggtagggagcga 412
             || | ||  ||||||||||||| ||||||||
Sbjct: 4067 gtgctgtctgatgggctggtggtggggagcga 4036



to top

>gb|BT019017.1| Zea mays clone Contig515.F mRNA sequence
          Length = 1513

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 327  cacttgtagctaagcagaactgagttgatgacatgcatga 366
            |||||||||||||||||||| ||||| || ||||||||||
Sbjct: 1144 cacttgtagctaagcagaaccgagttaattacatgcatga 1105



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                            
Query: 321      tagaaccacttgtagctaagcagaactgagttgatgacatgcatgagcaagcggagattg 380
                ||||| |||||||||||||||||||| || || || ||||||||||  |||||||   ||
Sbjct: 30034850 tagaatcacttgtagctaagcagaacagaattaattacatgcatgaataagcggatgctg 30034909

                                                
Query: 381      ctgttatccaatgggctggtggtagggagcga 412
                 || | ||  ||||||||||||| ||||||||
Sbjct: 30034910 gtgctgtctgatgggctggtggtggggagcga 30034941



to top

>dbj|AP005113.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0685G12
          Length = 149155

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 321   tagaaccacttgtagctaagcagaactgagttgatgacatgcatgagcaagcggagattg 380
             ||||| |||||||||||||||||||| || || || ||||||||||  |||||||   ||
Sbjct: 14447 tagaatcacttgtagctaagcagaacagaattaattacatgcatgaataagcggatgctg 14506

                                             
Query: 381   ctgttatccaatgggctggtggtagggagcga 412
              || | ||  ||||||||||||| ||||||||
Sbjct: 14507 gtgctgtctgatgggctggtggtggggagcga 14538



to top

>dbj|AP005052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0654B04
          Length = 156907

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                          
Query: 321    tagaaccacttgtagctaagcagaactgagttgatgacatgcatgagcaagcggagattg 380
              ||||| |||||||||||||||||||| || || || ||||||||||  |||||||   ||
Sbjct: 135126 tagaatcacttgtagctaagcagaacagaattaattacatgcatgaataagcggatgctg 135185

                                              
Query: 381    ctgttatccaatgggctggtggtagggagcga 412
               || | ||  ||||||||||||| ||||||||
Sbjct: 135186 gtgctgtctgatgggctggtggtggggagcga 135217



to top

>dbj|AK122035.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033112L23, full
            insert sequence
          Length = 4485

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 321  tagaaccacttgtagctaagcagaactgagttgatgacatgcatgagcaagcggagattg 380
            ||||| |||||||||||||||||||| || || || ||||||||||  |||||||   ||
Sbjct: 4126 tagaatcacttgtagctaagcagaacagaattaattacatgcatgaataagcggatgctg 4067

                                            
Query: 381  ctgttatccaatgggctggtggtagggagcga 412
             || | ||  ||||||||||||| ||||||||
Sbjct: 4066 gtgctgtctgatgggctggtggtggggagcga 4035



to top

>dbj|AK061221.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-210-F03, full
            insert sequence
          Length = 1316

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 321  tagaaccacttgtagctaagcagaactgagttgatgacatgcatgagcaagcggagattg 380
            ||||| |||||||||||||||||||| || || || ||||||||||  |||||||   ||
Sbjct: 1108 tagaatcacttgtagctaagcagaacagaattaattacatgcatgaataagcggatgctg 1049

                                            
Query: 381  ctgttatccaatgggctggtggtagggagcga 412
             || | ||  ||||||||||||| ||||||||
Sbjct: 1048 gtgctgtctgatgggctggtggtggggagcga 1017



to top

>gb|AY109484.1| Zea mays CL3541_1 mRNA sequence
          Length = 1061

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 327 cacttgtagctaagcagaactgagttgatgacatgcatga 366
           |||||||||||||||||||||||||| ||  |||||||||
Sbjct: 186 cacttgtagctaagcagaactgagttaattccatgcatga 225



to top

>emb|AL445564.1|MPULM02 Mycoplasma pulmonis (strain UAB CTIP) complete genome; segment 2/3
          Length = 321250

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 252    tttcaaaattttctctctata 272
              |||||||||||||||||||||
Sbjct: 244906 tttcaaaattttctctctata 244926



to top

>emb|AL645683.7| Mouse DNA sequence from clone RP23-374M7 on chromosome 13 Contains the
             V1ri9 gene for vomeronasal 1 receptor I9 and the gene for
             a novel vomeronasal 1 receptor I (V1ri) family member,
             complete sequence
          Length = 77611

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 274   aaagaaagaatagaccatcat 294
             |||||||||||||||||||||
Sbjct: 72317 aaagaaagaatagaccatcat 72297



to top

>emb|AL772408.4| Mouse DNA sequence from clone RP23-339B20 on chromosome 2, complete
              sequence
          Length = 208703

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 234    ttctagttttcccttgctttt 254
              |||||||||||||||||||||
Sbjct: 136503 ttctagttttcccttgctttt 136523



to top

>gb|AC099468.9| Rattus norvegicus 1 BAC CH230-37P5 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 212177

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 248    tgcttttcaaaattttctct 267
              ||||||||||||||||||||
Sbjct: 161572 tgcttttcaaaattttctct 161591



to top

>gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map human ortholog p11.3,
              complete sequence
          Length = 209530

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      catcaatcatattttgggtg 26
              ||||||||||||||||||||
Sbjct: 207609 catcaatcatattttgggtg 207628



to top

>emb|AL590364.5| Human DNA sequence from clone RP11-342D14 on chromosome X Contains the
             3' end of a novel gene, complete sequence
          Length = 65644

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     catcaatcatattttgggtg 26
             ||||||||||||||||||||
Sbjct: 57416 catcaatcatattttgggtg 57435



to top

>emb|AL138920.11| Human DNA sequence from clone RP11-148B2 on chromosome 10 Contains the
              RAB18 gene for RAB18, member RAS oncogene family and a CpG
              island, complete sequence
          Length = 168217

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    ttttcaaaattttctctcta 270
              ||||||||||||||||||||
Sbjct: 151009 ttttcaaaattttctctcta 150990



to top

>emb|AL135918.6| Human DNA sequence from clone RP1-89K8 on chromosome 6, complete
             sequence
          Length = 110716

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   tttttcttggtgacagtttt 225
             ||||||||||||||||||||
Sbjct: 58817 tttttcttggtgacagtttt 58836



to top

>emb|BX664015.1| Serratia marcescens plasmid R478
          Length = 274762

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 344    aactgagttgatgacatgcatgag 367
              |||||||||||||||||| |||||
Sbjct: 192053 aactgagttgatgacatgaatgag 192030



to top

>gb|AC119409.25| Medicago truncatula clone mth2-10i9, complete sequence
          Length = 127954

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 347   tgagttgatgacatgcatga 366
             ||||||||||||||||||||
Sbjct: 76929 tgagttgatgacatgcatga 76910



to top

>dbj|AK057337.1| Homo sapiens cDNA FLJ32775 fis, clone TESTI2002012
          Length = 2688

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 251 ttttcaaaattttctctctataca 274
           ||||| ||||||||||||||||||
Sbjct: 759 ttttccaaattttctctctataca 736



to top

>ref|XM_944060.1| PREDICTED: Homo sapiens hypothetical protein LOC145820 (LOC145820),
           mRNA
          Length = 2688

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 251 ttttcaaaattttctctctataca 274
           ||||| ||||||||||||||||||
Sbjct: 753 ttttccaaattttctctctataca 730



to top

>ref|XM_378546.2| PREDICTED: Homo sapiens hypothetical protein LOC145820 (LOC145820),
           mRNA
          Length = 2688

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 251 ttttcaaaattttctctctataca 274
           ||||| ||||||||||||||||||
Sbjct: 753 ttttccaaattttctctctataca 730



to top

>gb|AC008958.7| Homo sapiens chromosome 5 clone CTD-2353N24, complete sequence
          Length = 109526

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 250   cttttcaaaattttctctct 269
             ||||||||||||||||||||
Sbjct: 94246 cttttcaaaattttctctct 94265



to top

>dbj|AP002008.5| Homo sapiens genomic DNA, chromosome 11q clone:RP11-794P6, complete
              sequences
          Length = 194973

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 310    ctgcagccatttagaaccacttgt 333
              |||||||||||| |||||||||||
Sbjct: 132318 ctgcagccattttgaaccacttgt 132341



to top

>emb|AL591596.5| Zebrafish DNA sequence from clone XX-205M23, complete sequence
          Length = 84809

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 260   ttttctctctatacaaagaaagaa 283
             |||||||| |||||||||||||||
Sbjct: 51042 ttttctctttatacaaagaaagaa 51019


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,455,767
Number of Sequences: 3902068
Number of extensions: 4455767
Number of successful extensions: 96245
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 96158
Number of HSP's gapped (non-prelim): 87
length of query: 445
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 423
effective length of database: 17,147,199,772
effective search space: 7253265503556
effective search space used: 7253265503556
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top