ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl42g08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC104540.9| Mus musculus chromosome 5, clone RP23-301P15, com... 40 0.65
2gb|AC158149.3| Mus musculus chromosome 5, clone RP24-296L6, comp... 40 0.65
3emb|BX914212.8| Zebrafish DNA sequence from clone CH211-105P7 in... 40 0.65
4emb|BX323582.13| Zebrafish DNA sequence from clone CH211-143E19 ... 40 0.65
5gb|AC166253.18| Mus musculus BAC RP23-231M6 (Roswell Park Cance... 38 2.6
6gb|AY543467.1| Legionella pneumophila strain Chicago 8 IcmV prot... 38 2.6
7gb|AY543464.1| Legionella pneumophila strain Bloomington 2 IcmV ... 38 2.6
8gb|AY543462.1| Legionella pneumophila strain Amsterdam B-2 IcmV ... 38 2.6
9gb|AY543461.1| Legionella pneumophila strain Amsterdam B-1 IcmV ... 38 2.6
10gb|AY543459.1| Legionella pneumophila strain 797-PA-H IcmV prote... 38 2.6
11gb|AY543458.1| Legionella pneumophila strain Leiden 1 IcmV prote... 38 2.6
12gb|AY543457.1| Legionella pneumophila strain Los Angeles 1 IcmV ... 38 2.6
13gb|AY543455.1| Legionella pneumophila IcmV protein (icmV) gene, ... 38 2.6
14gb|AY543454.1| Legionella pneumophila strain IN-23-G1-C2 IcmV pr... 38 2.6
15gb|AY543453.1| Legionella pneumophila strain Concord 3 IcmV prot... 38 2.6
16gb|AY543452.1| Legionella pneumophila strain Bellingham 1 IcmV p... 38 2.6
17gb|AC121871.3| Mus musculus BAC clone RP24-121J1 from chromosome... 38 2.6
18emb|CR628337.1| Legionella pneumophila str. Lens complete genome 38 2.6
19emb|CR628336.1| Legionella pneumophila str. Paris complete genome 38 2.6
20gb|AC138466.12| Homo sapiens 12 BAC RP13-977J11 (Roswell Park Ca... 38 2.6 
>gb|AC104540.9| Mus musculus chromosome 5, clone RP23-301P15, complete sequence
          Length = 221681

 Score = 40.1 bits (20), Expect = 0.65
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     aaatgaacacatgtttcata 21
             ||||||||||||||||||||
Sbjct: 17637 aaatgaacacatgtttcata 17656
to top
>gb|AC158149.3| Mus musculus chromosome 5, clone RP24-296L6, complete sequence
          Length = 155517

 Score = 40.1 bits (20), Expect = 0.65
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      aaatgaacacatgtttcata 21
              ||||||||||||||||||||
Sbjct: 122262 aaatgaacacatgtttcata 122281
to top
>emb|BX914212.8| Zebrafish DNA sequence from clone CH211-105P7 in linkage group 18,
             complete sequence
          Length = 67940

 Score = 40.1 bits (20), Expect = 0.65
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    tgtttcataaccacaaccaa 32
             ||||||||||||||||||||
Sbjct: 22022 tgtttcataaccacaaccaa 22003
to top
>emb|BX323582.13| Zebrafish DNA sequence from clone CH211-143E19 in linkage group 18,
             complete sequence
          Length = 80226

 Score = 40.1 bits (20), Expect = 0.65
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    tgtttcataaccacaaccaa 32
             ||||||||||||||||||||
Sbjct: 38806 tgtttcataaccacaaccaa 38825
to top
>gb|AC166253.18| Mus musculus  BAC RP23-231M6 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 207999

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 4     atgaacacatgtttcataa 22
             |||||||||||||||||||
Sbjct: 29310 atgaacacatgtttcataa 29292
to top
>gb|AY543467.1| Legionella pneumophila strain Chicago 8 IcmV protein (icmV) gene,
           complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543464.1| Legionella pneumophila strain Bloomington 2 IcmV protein (icmV)
           gene, complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543462.1| Legionella pneumophila strain Amsterdam B-2 IcmV protein (icmV)
           gene, complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543461.1| Legionella pneumophila strain Amsterdam B-1 IcmV protein (icmV)
           gene, complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543459.1| Legionella pneumophila strain 797-PA-H IcmV protein (icmV) gene,
           complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543458.1| Legionella pneumophila strain Leiden 1 IcmV protein (icmV) gene,
           complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543457.1| Legionella pneumophila strain Los Angeles 1 IcmV protein (icmV)
           gene, complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543455.1| Legionella pneumophila IcmV protein (icmV) gene, complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543454.1| Legionella pneumophila strain IN-23-G1-C2 IcmV protein (icmV) gene,
           complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543453.1| Legionella pneumophila strain Concord 3 IcmV protein (icmV) gene,
           complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AY543452.1| Legionella pneumophila strain Bellingham 1 IcmV protein (icmV)
           gene, complete cds
          Length = 456

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 17  tcataaccacaaccaaact 35
           |||||||||||||||||||
Sbjct: 340 tcataaccacaaccaaact 322
to top
>gb|AC121871.3| Mus musculus BAC clone RP24-121J1 from chromosome 10, complete
            sequence
          Length = 214405

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 4    atgaacacatgtttcataa 22
            |||||||||||||||||||
Sbjct: 5424 atgaacacatgtttcataa 5442
to top
>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      tcataaccacaaccaaact 35
               |||||||||||||||||||
Sbjct: 2984466 tcataaccacaaccaaact 2984484
to top
>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 17      tcataaccacaaccaaact 35
               |||||||||||||||||||
Sbjct: 3124826 tcataaccacaaccaaact 3124844
to top
>gb|AC138466.12| Homo sapiens 12 BAC RP13-977J11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 129492

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    cacaaccaaactcccccca 42
             |||||||||||||||||||
Sbjct: 61929 cacaaccaaactcccccca 61911


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 499,879
Number of Sequences: 3902068
Number of extensions: 499879
Number of successful extensions: 33879
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33844
Number of HSP's gapped (non-prelim): 35
length of query: 67
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 46
effective length of database: 17,151,101,840
effective search space: 788950684640
effective search space used: 788950684640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top