ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl42e09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 180 2e-42
2dbj|AP004087.3| Oryza sativa (japonica cultivar-group) genomic D... 180 2e-42
3ref|NM_128071.2| Arabidopsis thaliana ATP binding / ATPase/ nucl... 70 5e-09
4gb|AY070722.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, co... 70 5e-09
5gb|BT002223.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, co... 70 5e-09
6gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.2
7ref|XM_570285.1| Cryptococcus neoformans var. neoformans JEC21 c... 42 1.2
8gb|AY327614.1| Cryptococcus bacillisporus strain B4546 superoxid... 42 1.2
9gb|AY327613.1| Cryptococcus bacillisporus strain NIH312 superoxi... 42 1.2
10gb|AC105091.3| Homo sapiens chromosome 8, clone RP11-479P21, com... 42 1.2
11gb|AF248051.1|AF248051 Filobasidiella neoformans var. bacillispo... 42 1.2
12gb|AF248050.1|AF248050 Filobasidiella neoformans var. bacillispo... 42 1.2
13gb|AF248048.1|AF248048 Filobasidiella neoformans var. neoformans... 42 1.2
14gb|AF248047.1|AF248047 Filobasidiella neoformans var. neoformans... 42 1.2
15dbj|AB209690.1| Homo sapiens mRNA for ADAM 32 precursor (A disin... 42 1.2
16gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete... 40 4.7
17gb|AC122385.2| Mus musculus BAC clone RP24-72B22 from chromosome... 40 4.7
18gb|AC113279.7| Mus musculus chromosome 3, clone RP23-389J8, comp... 40 4.7
19emb|AL732437.12| Human DNA sequence from clone RP11-116G8 on chr... 40 4.7
20ref|XM_793553.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.7
21emb|AL162972.1|ATT1E3 Arabidopsis thaliana DNA chromosome 5, BAC... 40 4.7
22gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence 40 4.7
23dbj|AB008271.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 4.7
24emb|AJ251786.1|ATU251786 Agrobacterium tumefaciens strain C58 pa... 40 4.7
25emb|AJ251785.1|ATU251785 Agrobacterium tumefaciens strain D44 pa... 40 4.7

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  180 bits (91), Expect = 2e-42
 Identities = 184/215 (85%)
 Strand = Plus / Plus

                                                                           
Query: 137     tctaacctctgaaggaccagctgcttctttggagcaaagcctttggcaatcgacacagag 196
               ||||||||||| ||||| |||| ||||| |||||||| |||||| || |||| ||| |||
Sbjct: 4567873 tctaacctctggaggacaagcttcttctgtggagcaaggcctttcgcgatcgccacggag 4567932

                                                                           
Query: 197     cttacatccaccacaacggtatcatcctccttgaagtcacccttgaggacagcaagagct 256
               || || || || |  ||||| || || || |||||||| ||||| ||||||   || || 
Sbjct: 4567933 ctcacgtcgacgaggacggtgtcgtcttctttgaagtcgcccttcaggacactgagggcg 4567992

                                                                           
Query: 257     atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 316
               ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 4567993 atctcgttctctaccatctgctggatcaccctcttcacaggcctagcaccgtagttaggg 4568052

                                                  
Query: 317     tcaaagccaagagcgccgagatgctccacagcttc 351
               |||||||| |||| ||| |||||||||||||||||
Sbjct: 4568053 tcaaagccgagagagccaagatgctccacagcttc 4568087



to top

>dbj|AP004087.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1297_C09
          Length = 163378

 Score =  180 bits (91), Expect = 2e-42
 Identities = 184/215 (85%)
 Strand = Plus / Plus

                                                                          
Query: 137    tctaacctctgaaggaccagctgcttctttggagcaaagcctttggcaatcgacacagag 196
              ||||||||||| ||||| |||| ||||| |||||||| |||||| || |||| ||| |||
Sbjct: 103252 tctaacctctggaggacaagcttcttctgtggagcaaggcctttcgcgatcgccacggag 103311

                                                                          
Query: 197    cttacatccaccacaacggtatcatcctccttgaagtcacccttgaggacagcaagagct 256
              || || || || |  ||||| || || || |||||||| ||||| ||||||   || || 
Sbjct: 103312 ctcacgtcgacgaggacggtgtcgtcttctttgaagtcgcccttcaggacactgagggcg 103371

                                                                          
Query: 257    atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 316
              ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 103372 atctcgttctctaccatctgctggatcaccctcttcacaggcctagcaccgtagttaggg 103431

                                                 
Query: 317    tcaaagccaagagcgccgagatgctccacagcttc 351
              |||||||| |||| ||| |||||||||||||||||
Sbjct: 103432 tcaaagccgagagagccaagatgctccacagcttc 103466



to top

>ref|NM_128071.2| Arabidopsis thaliana ATP binding / ATPase/ nucleoside-triphosphatase/
            nucleotide binding / protein binding AT2G25140 mRNA,
            complete cds
          Length = 3223

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 257  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 316
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2913 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2854

                       
Query: 317  tcaaagccaag 327
            |||||||||||
Sbjct: 2853 tcaaagccaag 2843



to top

>gb|AY070722.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, complete cds
          Length = 3223

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 257  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 316
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2913 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2854

                       
Query: 317  tcaaagccaag 327
            |||||||||||
Sbjct: 2853 tcaaagccaag 2843



to top

>gb|BT002223.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, complete cds
          Length = 2895

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 257  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 316
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2759 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2700

                       
Query: 317  tcaaagccaag 327
            |||||||||||
Sbjct: 2699 tcaaagccaag 2689



to top

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
              sequence
          Length = 1783081

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 231    agtcacccttgaggacagcaa 251
              |||||||||||||||||||||
Sbjct: 417427 agtcacccttgaggacagcaa 417447



to top

>ref|XM_570285.1| Cryptococcus neoformans var. neoformans JEC21 copper zinc
           superoxide dismutase (CND01490) partial mRNA
          Length = 664

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 agtcacccttgaggacagcaa 251
           |||||||||||||||||||||
Sbjct: 112 agtcacccttgaggacagcaa 92



to top

>gb|AY327614.1| Cryptococcus bacillisporus strain B4546 superoxide dismutase (SOD1)
           gene, partial cds
          Length = 830

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 agtcacccttgaggacagcaa 251
           |||||||||||||||||||||
Sbjct: 183 agtcacccttgaggacagcaa 163



to top

>gb|AY327613.1| Cryptococcus bacillisporus strain NIH312 superoxide dismutase
           (SOD1) gene, partial cds
          Length = 830

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 agtcacccttgaggacagcaa 251
           |||||||||||||||||||||
Sbjct: 183 agtcacccttgaggacagcaa 163



to top

>gb|AC105091.3| Homo sapiens chromosome 8, clone RP11-479P21, complete sequence
          Length = 173888

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 165    ttggagcaaagcctttggcaa 185
              |||||||||||||||||||||
Sbjct: 106545 ttggagcaaagcctttggcaa 106565



to top

>gb|AF248051.1|AF248051 Filobasidiella neoformans var. bacillispora WM 780-C copper zinc
           superoxide dismutase (SOD1) gene, complete cds
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 agtcacccttgaggacagcaa 251
           |||||||||||||||||||||
Sbjct: 398 agtcacccttgaggacagcaa 378



to top

>gb|AF248050.1|AF248050 Filobasidiella neoformans var. bacillispora NYS 155B copper zinc
           superoxide dismutase (SOD1) gene, complete cds
          Length = 1824

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 agtcacccttgaggacagcaa 251
           |||||||||||||||||||||
Sbjct: 907 agtcacccttgaggacagcaa 887



to top

>gb|AF248048.1|AF248048 Filobasidiella neoformans var. neoformans B-3501 copper zinc
           superoxide dismutase (SOD1) gene, complete cds
          Length = 1915

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 agtcacccttgaggacagcaa 251
           |||||||||||||||||||||
Sbjct: 868 agtcacccttgaggacagcaa 848



to top

>gb|AF248047.1|AF248047 Filobasidiella neoformans var. neoformans B-3501 copper zinc
           superoxide dismutase (SOD1) mRNA, complete cds
          Length = 681

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 231 agtcacccttgaggacagcaa 251
           |||||||||||||||||||||
Sbjct: 121 agtcacccttgaggacagcaa 101



to top

>dbj|AB209690.1| Homo sapiens mRNA for ADAM 32 precursor (A disintegrin and
            metalloprotease domain 32) variant protein
          Length = 6873

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 165  ttggagcaaagcctttggcaa 185
            |||||||||||||||||||||
Sbjct: 5288 ttggagcaaagcctttggcaa 5308



to top

>gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete sequence
          Length = 196954

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 265   ctccaccatctgctggatca 284
             ||||||||||||||||||||
Sbjct: 24679 ctccaccatctgctggatca 24660



to top

>gb|AC122385.2| Mus musculus BAC clone RP24-72B22 from chromosome 1, complete sequence
          Length = 178821

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 31    atttcctggggaaaggttctcact 54
             ||||||||||||| ||||||||||
Sbjct: 66254 atttcctggggaagggttctcact 66277



to top

>gb|AC113279.7| Mus musculus chromosome 3, clone RP23-389J8, complete sequence
          Length = 198009

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 30    catttcctggggaaaggttc 49
             ||||||||||||||||||||
Sbjct: 51203 catttcctggggaaaggttc 51184



to top

>emb|AL732437.12| Human DNA sequence from clone RP11-116G8 on chromosome 10 Contains the
             NET1 gene for neuroepithelial cell transforming gene 1,
             the gene for calmodulin-like skin protein (CLSP), the
             CALML3 gene for calmodulin-like 3 (CLP) and four CpG
             islands, complete sequence
          Length = 183441

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 15    caactcccattcatgcatttcctg 38
             |||||||||||| |||||||||||
Sbjct: 90008 caactcccattcctgcatttcctg 90031



to top

>ref|XM_793553.1| PREDICTED: Strongylocentrotus purpuratus similar to protein
           tyrosine phosphatase, non-receptor type 4 (LOC594103),
           mRNA
          Length = 1803

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 323 ccaagagcgccgagatgctc 342
           ||||||||||||||||||||
Sbjct: 437 ccaagagcgccgagatgctc 456



to top

>emb|AL162972.1|ATT1E3 Arabidopsis thaliana DNA chromosome 5, BAC clone T1E3 (ESSA project)
          Length = 83485

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ctggggaaaggttctcacta 55
             ||||||||||||||||||||
Sbjct: 61896 ctggggaaaggttctcacta 61915



to top

>gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence
          Length = 172761

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 265    ctccaccatctgctggatca 284
              ||||||||||||||||||||
Sbjct: 113136 ctccaccatctgctggatca 113155



to top

>dbj|AB008271.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUK11
          Length = 79073

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ctggggaaaggttctcacta 55
             ||||||||||||||||||||
Sbjct: 19509 ctggggaaaggttctcacta 19528



to top

>emb|AJ251786.1|ATU251786 Agrobacterium tumefaciens strain C58 partial vppa gene for putative
           proton-translocating inorganic pyrophosphatase (isoform
           II)
          Length = 567

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 169 agcaaagcctttggcaatcg 188
           ||||||||||||||||||||
Sbjct: 108 agcaaagcctttggcaatcg 89



to top

>emb|AJ251785.1|ATU251785 Agrobacterium tumefaciens strain D44 partial vppa gene for putative
           proton-translocating inorganic pyrophosphatase (isoform
           II)
          Length = 567

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 169 agcaaagcctttggcaatcg 188
           ||||||||||||||||||||
Sbjct: 108 agcaaagcctttggcaatcg 89


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,753,097
Number of Sequences: 3902068
Number of extensions: 2753097
Number of successful extensions: 47588
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47534
Number of HSP's gapped (non-prelim): 52
length of query: 353
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 331
effective length of database: 17,147,199,772
effective search space: 5675723124532
effective search space used: 5675723124532
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top