ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl42d03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK070310.1| Oryza sativa (japonica cultivar-group) cDNA clon... 246 5e-62
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 147 3e-32
3dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic D... 147 3e-32
4dbj|AP005609.3| Oryza sativa (japonica cultivar-group) genomic D... 147 3e-32
5ref|NM_101539.1| Arabidopsis thaliana AVPL1 (VACUOLAR-PYROPHOSPH... 92 2e-15
6emb|BX817279.1|CNS0AB7C Arabidopsis thaliana Full-length cDNA Co... 88 3e-14
7ref|NM_106541.2| Arabidopsis thaliana AVP2 AT1G78920 (AVP2) mRNA... 80 7e-12
8gb|BT010353.1| Arabidopsis thaliana At1g78920 mRNA, complete cds 80 7e-12
9dbj|AK220927.1| Arabidopsis thaliana mRNA for vacuolar-pyrophosp... 80 7e-12
10gb|AY054485.1| Arabidopsis thaliana Similar to vacuolar H+-pyrop... 80 7e-12
11emb|BX815888.1|CNS0ABNT Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
12emb|BX816636.1|CNS0AAKC Arabidopsis thaliana Full-length cDNA Co... 80 7e-12
13gb|AF182813.1|AF182813 Arabidopsis thaliana vacuolar-type H+-tra... 80 7e-12
14dbj|AB034696.1| Arabidopsis thaliana AVPL1 mRNA for vacuolar-pyr... 80 7e-12
15gb|AF184917.1|AF184917 Arabidopsis thaliana vacuolar-type H+-tra... 66 1e-07
16gb|AC005679.1|F9K20 Arabidopsis thaliana chromosome 1 BAC F9K20 ... 66 1e-07
17gb|L32792.1|BEUPYROA Beta vulgaris clone P1 pyrophosphatase mRNA... 60 6e-06
18gb|L32791.1|BEUPYRO Beta vulgaris clone P2 pyrophosphatase mRNA,... 60 6e-06
19dbj|AP006375.1| Lotus japonicus genomic DNA, chromosome 4, clone... 60 6e-06
20gb|AC026237.4|AC026237 Arabidopsis thaliana chromosome I BAC F17... 58 2e-05
21emb|X83729.1|NTIPTVP31 N.tabacum mRNA for inorganic pyrophosphat... 58 2e-05
22dbj|D86306.1| Cucurbita moschata mRNA for proton-translocating i... 58 2e-05
23gb|AF367446.1| Prunus persica clone Vp1 vacuolar H+-pyrophosphat... 56 1e-04
24emb|X83728.1|NTIPTVP17 N.tabacum mRNA for inorganic pyrophosphat... 56 1e-04
25emb|AJ557256.2|VVI557256 Vitis vinifera mRNA for vacuolar pyroph... 54 4e-04
26emb|AJ278019.1|LES278019 Lycopersicon esculentum partial mRNA fo... 54 4e-04
27gb|AY514019.1| Hevea brasiliensis PPase mRNA, complete cds 52 0.002
28ref|XM_722505.1| Plasmodium yoelii yoelii str. 17XNL V-type H(+)... 52 0.002
29ref|XM_734957.1| Plasmodium chabaudi chabaudi V-type H(+)-transl... 52 0.002
30gb|AC151744.23| Medicago truncatula clone mth2-32k10, complete s... 52 0.002
31gb|DQ443731.1| Chenopodium glaucum vacuolar H+-pyrophosphatase (... 52 0.002
32gb|AF533336.1| Chenopodium rubrum vacuolar proton-pumping PPase ... 52 0.002
33gb|AE011990.1| Xanthomonas axonopodis pv. citri str. 306, secti... 52 0.002
34dbj|AB097115.1| Pyrus communis PVP3 mRNA for vacuolar proton-ino... 52 0.002
35gb|AY458638.2| Uncultured bacterium 441 clone EBAC080-L31C11 gen... 50 0.006
36ref|XM_671151.1| Plasmodium berghei strain ANKA V-type H(+)-tran... 50 0.006
37gb|AY103622.1| Zea mays PCO084888 mRNA sequence 50 0.006
38dbj|AB009077.1| Vigna radiata mRNA for proton pyrophosphatase, c... 50 0.006
39gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 48 0.024
40gb|AF367447.1| Prunus persica clone Vp2 vacuolar H+-pyrophosphat... 48 0.024
41dbj|AK119631.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.093
42dbj|AK099807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.093
43gb|U31467.1|VRU31467 Vigna radiata pyrophosphatase mRNA, complet... 46 0.093
44dbj|D45383.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase,... 46 0.093
45ref|XM_476313.1| Oryza sativa (japonica cultivar-group), predic... 44 0.37
46gb|AF533337.1| Chenopodium rubrum vacuolar proton-pumping PPase ... 44 0.37
47gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete... 44 0.37
48dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.37
49dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase,... 44 0.37
50dbj|D88820.1| Acetabularia mediterranea mRNA for inorganic pyrop... 44 0.37
51emb|AL355986.7| Human DNA sequence from clone RP11-516G5 on chro... 42 1.5
52gb|AC119677.2| Homo sapiens chromosome 1 clone RP5-1066H13, comp... 42 1.5
53dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.5
54gb|CP000249.1| Frankia sp. CcI3, complete genome 42 1.5
55emb|BX571676.5| Zebrafish DNA sequence from clone DKEY-242N5 in ... 42 1.5
56gb|AY255181.1| Hordeum brevisubulatum vacuolar proton-inorganic ... 42 1.5
57gb|AF009568.1|AF009568 Gossypium hirsutum H+-pyrophosphatase (VP... 42 1.5
58gb|AC157991.5| Mus musculus chromosome 18, clone RP23-335B10, co... 40 5.7
59gb|AC102155.10| Mus musculus chromosome 18, clone RP23-334J12, c... 40 5.7
60gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, co... 40 5.7
61gb|AC153972.6| Mus musculus 10 BAC RP24-383P4 (Roswell Park Canc... 40 5.7
62gb|AC132608.2| Mus musculus BAC clone RP23-451E12 from chromosom... 40 5.7
63emb|AJ843206.1| Cryptosporidium parvum partial vppI gene for pro... 40 5.7
64ref|XM_741135.1| Plasmodium chabaudi chabaudi vacuolar-type H+-t... 40 5.7
65ref|XM_674568.1| Plasmodium berghei strain ANKA vacuolar-type H+... 40 5.7
66emb|AL118511.25|HSDJ858B6 Human DNA sequence from clone RP5-858B... 40 5.7
67emb|AL031687.17|HS998H6 Human DNA sequence from clone RP5-998H6 ... 40 5.7
68dbj|AP007170.1| Aspergillus oryzae RIB40 genomic DNA, SC138 40 5.7
69gb|AC016657.5| Homo sapiens chromosome 5 clone RP1-6C3, complete... 40 5.7
70gb|AC159504.5| Mus musculus 10 BAC RP23-302J6 (Roswell Park Canc... 40 5.7
71gb|AF532114.1| Mus musculus strain 129/SvJ BAC clone citb544e14 ... 40 5.7
72gb|AC069275.3|AC069275 Homo sapiens chromosome 3 clone RP11-194C... 40 5.7
73gb|AC023472.4|AC023472 Homo sapiens chromosome 3 clone RP11-156B... 40 5.7
74dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane... 40 5.7
75gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complet... 40 5.7
76gb|AC069276.4| Homo sapiens chromosome 3 clone RP11-470E10 map 3... 40 5.7
77gb|AC018832.5| Homo sapiens chromosome 3 clone RP11-481O7 map 3p... 40 5.7
78dbj|AB018529.1| Chara corallina CPP1 mRNA for vacuolar H+-pyroph... 40 5.7 
>dbj|AK070310.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047F16, full
            insert sequence
          Length = 3048

 Score =  246 bits (124), Expect = 5e-62
 Identities = 169/184 (91%)
 Strand = Plus / Minus

                                                                        
Query: 237  ggagccatgaccagtgtgatcgtggcgagcatcttgatgagaacatggatcgaaggcccc 296
            |||||||| || | |||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 2881 ggagccatcactaatgtgattgtagcgagcatcttaataagaacatggatggaaggcccc 2822

                                                                        
Query: 297  gccgtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctca 356
            ||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 2821 gccgtgtctttaaatggatctccaaccgtatcaccagtaactgcagccttgtgagactca 2762

                                                                        
Query: 357  ctgcctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacca 416
            |||||||| |||||||| || |||||||||||||||||||||||||||||||| ||||||
Sbjct: 2761 ctgcctttgccaccaagagcgccagtctcgatgtacttcttagcattatcccaggcacca 2702

                
Query: 417  ccag 420
            ||||
Sbjct: 2701 ccag 2698
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  147 bits (74), Expect = 3e-32
 Identities = 92/98 (93%)
 Strand = Plus / Plus

                                                                            
Query: 323      cgtatcaccagtaattgcagccttgtgagcctcactgcctttaccaccaagtgcaccagt 382
                |||||||||||||| |||||||||||||| |||||||||||| |||||||| || |||||
Sbjct: 19932561 cgtatcaccagtaactgcagccttgtgagactcactgcctttgccaccaagagcgccagt 19932620

                                                      
Query: 383      ctcgatgtacttcttagcattatcccaagcaccaccag 420
                ||||||||||||||||||||||||||| ||||||||||
Sbjct: 19932621 ctcgatgtacttcttagcattatcccaggcaccaccag 19932658



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                            
Query: 237      ggagccatgaccagtgtgatcgtggcgagcatcttgatgagaacatggatcgaaggcccc 296
                |||||||| || | |||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 19932104 ggagccatcactaatgtgattgtagcgagcatcttaataagaacatggatggaaggcccc 19932163

                                           
Query: 297      gccgtgtctttgaatggatctccaacc 323
                ||||||||||| |||||||||||||||
Sbjct: 19932164 gccgtgtctttaaatggatctccaacc 19932190
to top
>dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0508B05
          Length = 166165

 Score =  147 bits (74), Expect = 3e-32
 Identities = 92/98 (93%)
 Strand = Plus / Plus

                                                                          
Query: 323    cgtatcaccagtaattgcagccttgtgagcctcactgcctttaccaccaagtgcaccagt 382
              |||||||||||||| |||||||||||||| |||||||||||| |||||||| || |||||
Sbjct: 110162 cgtatcaccagtaactgcagccttgtgagactcactgcctttgccaccaagagcgccagt 110221

                                                    
Query: 383    ctcgatgtacttcttagcattatcccaagcaccaccag 420
              ||||||||||||||||||||||||||| ||||||||||
Sbjct: 110222 ctcgatgtacttcttagcattatcccaggcaccaccag 110259



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                          
Query: 237    ggagccatgaccagtgtgatcgtggcgagcatcttgatgagaacatggatcgaaggcccc 296
              |||||||| || | |||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 109705 ggagccatcactaatgtgattgtagcgagcatcttaataagaacatggatggaaggcccc 109764

                                         
Query: 297    gccgtgtctttgaatggatctccaacc 323
              ||||||||||| |||||||||||||||
Sbjct: 109765 gccgtgtctttaaatggatctccaacc 109791
to top
>dbj|AP005609.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0014M17
          Length = 156778

 Score =  147 bits (74), Expect = 3e-32
 Identities = 92/98 (93%)
 Strand = Plus / Plus

                                                                         
Query: 323   cgtatcaccagtaattgcagccttgtgagcctcactgcctttaccaccaagtgcaccagt 382
             |||||||||||||| |||||||||||||| |||||||||||| |||||||| || |||||
Sbjct: 36682 cgtatcaccagtaactgcagccttgtgagactcactgcctttgccaccaagagcgccagt 36741

                                                   
Query: 383   ctcgatgtacttcttagcattatcccaagcaccaccag 420
             ||||||||||||||||||||||||||| ||||||||||
Sbjct: 36742 ctcgatgtacttcttagcattatcccaggcaccaccag 36779



 Score =  101 bits (51), Expect = 2e-18
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                         
Query: 237   ggagccatgaccagtgtgatcgtggcgagcatcttgatgagaacatggatcgaaggcccc 296
             |||||||| || | |||||| || ||||||||||| || ||||||||||| |||||||||
Sbjct: 36225 ggagccatcactaatgtgattgtagcgagcatcttaataagaacatggatggaaggcccc 36284

                                        
Query: 297   gccgtgtctttgaatggatctccaacc 323
             ||||||||||| |||||||||||||||
Sbjct: 36285 gccgtgtctttaaatggatctccaacc 36311
to top
>ref|NM_101539.1| Arabidopsis thaliana AVPL1 (VACUOLAR-PYROPHOSPHATASE LIKE PROTEIN 1)
            AT1G16780 (AVPL1) mRNA, complete cds
          Length = 2578

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 151/186 (81%)
 Strand = Plus / Minus

                                                                        
Query: 230  aaagatcggagccatgaccagtgtgatcgtggcgagcatcttgatgagaacatggatcga 289
            |||||| ||||||||||| || ||||| || || | ||| ||||||||||| || |||||
Sbjct: 2403 aaagataggagccatgacaagcgtgatagtcgccaacattttgatgagaacgtgaatcga 2344

                                                                        
Query: 290  aggccccgccgtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtg 349
             || || || ||||| ||||| || ||||| || ||||||||||| | |||||| |||||
Sbjct: 2343 cggtcctgctgtgtccttgaaagggtctcccacagtatcaccagttactgcagctttgtg 2284

                                                                        
Query: 350  agcctcactgcctttaccaccaagtgcaccagtctcgatgtacttcttagcattatccca 409
             |  ||||| ||||| || || || || |||||||| ||||| ||||| ||||| |||||
Sbjct: 2283 ggaatcacttcctttgcctcctagagctccagtctcaatgtatttctttgcattgtccca 2224

                  
Query: 410  agcacc 415
            ||||||
Sbjct: 2223 agcacc 2218
to top
>emb|BX817279.1|CNS0AB7C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL10ZC09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 508

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
           ||||| ||||| |||||||| || |||||||||||||  || || |||||||| ||||| 
Sbjct: 237 gtgtccttgaacggatctcccacggtatcaccagtaacagctgctttgtgagcttcactt 178

                                                                   
Query: 360 cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
           ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 177 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 122
to top
>ref|NM_106541.2| Arabidopsis thaliana AVP2 AT1G78920 (AVP2) mRNA, complete cds
          Length = 3082

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                        
Query: 300  gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
            ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 2786 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 2727

                                                                    
Query: 360  cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 2726 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 2671
to top
>gb|BT010353.1| Arabidopsis thaliana At1g78920 mRNA, complete cds
          Length = 2409

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                        
Query: 300  gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
            ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 2333 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 2274

                                                                    
Query: 360  cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 2273 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 2218
to top
>dbj|AK220927.1| Arabidopsis thaliana mRNA for vacuolar-pyrophosphatase like
           protein, complete cds, clone: RAFL22-50-C13
          Length = 1137

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 300 gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
           ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 832 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 773

                                                                   
Query: 360 cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
           ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 772 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 717
to top
>gb|AY054485.1| Arabidopsis thaliana Similar to vacuolar H+-pyrophosphatase
            (At1g78920; F9K20.2) mRNA, complete cds
          Length = 3080

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                        
Query: 300  gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
            ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 2784 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 2725

                                                                    
Query: 360  cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 2724 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 2669
to top
>emb|BX815888.1|CNS0ABNT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH15ZB05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 567

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                       
Query: 300 gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
           ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 282 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 223

                                                                   
Query: 360 cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
           ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 222 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 167
to top
>emb|BX816636.1|CNS0AAKC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH5ZE09 of Hormone Treated Callus of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 3011

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                        
Query: 300  gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
            ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 2759 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 2700

                                                                    
Query: 360  cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 2699 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 2644
to top
>gb|AF182813.1|AF182813 Arabidopsis thaliana vacuolar-type H+-translocating inorganic
            pyrophosphatase (AVP2) mRNA, complete cds
          Length = 2403

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                        
Query: 300  gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
            ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 2327 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 2268

                                                                    
Query: 360  cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 2267 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 2212
to top
>dbj|AB034696.1| Arabidopsis thaliana AVPL1 mRNA for vacuolar-pyrophosphatase like
            protein, complete cds
          Length = 2991

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Minus

                                                                        
Query: 300  gtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtgagcctcactg 359
            ||||| ||||| |||||||| || ||||||||||| |  || || |||||||| ||||| 
Sbjct: 2704 gtgtccttgaacggatctcccacggtatcaccagtcacagctgctttgtgagcttcactt 2645

                                                                    
Query: 360  cctttaccaccaagtgcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||| || |||||||| || ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 2644 cctttgcccccaagtgccccggtctctatgtatttctttgcattgtcccaagcacc 2589
to top
>gb|AF184917.1|AF184917 Arabidopsis thaliana vacuolar-type H+-translocating inorganic
            pyrophosphatase (AVP2) gene, complete cds
          Length = 7500

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                        
Query: 323  cgtatcaccagtaattgcagccttgtgagcctcactgcctttaccaccaagtgcaccagt 382
            |||||||||||| |  || || |||||||| ||||| ||||| || |||||||| || ||
Sbjct: 1313 cgtatcaccagtcacagctgctttgtgagcttcacttcctttgcccccaagtgccccggt 1372

                                             
Query: 383  ctcgatgtacttcttagcattatcccaagcacc 415
            ||| ||||| ||||| ||||| |||||||||||
Sbjct: 1373 ctctatgtatttctttgcattgtcccaagcacc 1405
to top
>gb|AC005679.1|F9K20 Arabidopsis thaliana chromosome 1 BAC F9K20 sequence, complete
            sequence
          Length = 90425

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                        
Query: 323  cgtatcaccagtaattgcagccttgtgagcctcactgcctttaccaccaagtgcaccagt 382
            |||||||||||| |  || || |||||||| ||||| ||||| || |||||||| || ||
Sbjct: 1313 cgtatcaccagtcacagctgctttgtgagcttcacttcctttgcccccaagtgccccggt 1372

                                             
Query: 383  ctcgatgtacttcttagcattatcccaagcacc 415
            ||| ||||| ||||| ||||| |||||||||||
Sbjct: 1373 ctctatgtatttctttgcattgtcccaagcacc 1405
to top
>gb|L32792.1|BEUPYROA Beta vulgaris clone P1 pyrophosphatase mRNA, complete cds
          Length = 2801

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||| ||||||||||| ||||| ||||||||||||||||
Sbjct: 2156 gcaccagcctcaatgtacttcttggcattgtcccaagcaccaccag 2111
to top
>gb|L32791.1|BEUPYRO Beta vulgaris clone P2 pyrophosphatase mRNA, complete cds
          Length = 2868

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||||||||||||||| ||||| ||||| ||||||||||
Sbjct: 2287 gcaccagcctcgatgtacttcttggcattgtcccatgcaccaccag 2242
to top
>dbj|AP006375.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT32M04, TM0219,
             complete sequence
          Length = 72880

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                               
Query: 387   atgtacttcttagcattatcccaagcaccaccag 420
             ||||||||||| ||||||||||||||||||||||
Sbjct: 42498 atgtacttcttggcattatcccaagcaccaccag 42465
to top
>gb|AC026237.4|AC026237 Arabidopsis thaliana chromosome I BAC F17F16 genomic sequence, complete
             sequence
          Length = 90498

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 77/93 (82%)
 Strand = Plus / Minus

                                                                         
Query: 323   cgtatcaccagtaattgcagccttgtgagcctcactgcctttaccaccaagtgcaccagt 382
             |||||||||||| | |||||| ||||| |  ||||| ||||| || || || || |||||
Sbjct: 61240 cgtatcaccagttactgcagctttgtgggaatcacttcctttgcctcctagagctccagt 61181

                                              
Query: 383   ctcgatgtacttcttagcattatcccaagcacc 415
             ||| ||||| ||||| ||||| |||||||||||
Sbjct: 61180 ctcaatgtatttctttgcattgtcccaagcacc 61148



 Score = 44.1 bits (22), Expect = 0.37
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                         
Query: 230   aaagatcggagccatgaccagtgtgatcgtggcgagcatcttgatgagaacatggatcga 289
             |||||| ||||||||||| || ||||| || || | ||| ||||||||||| || |||||
Sbjct: 61462 aaagataggagccatgacaagcgtgatagtcgccaacattttgatgagaacgtgaatcga 61403

                                           
Query: 290   aggccccgccgtgtctttgaatggatctcc 319
              || || || ||||| ||||| || |||||
Sbjct: 61402 cggtcctgctgtgtccttgaaagggtctcc 61373
to top
>emb|X83729.1|NTIPTVP31 N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone)
          Length = 2867

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 378  ccagtctcgatgtacttcttagcattatcccaagcaccacc 418
            |||| ||| ||||||||||||||||||||||| ||||||||
Sbjct: 2453 ccagcctcaatgtacttcttagcattatcccaggcaccacc 2413
to top
>dbj|D86306.1| Cucurbita moschata mRNA for proton-translocating inorganic
            pyrophosphatase, complete cds
          Length = 2704

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||||| |||||||||||||||||| |||||||| |||||
Sbjct: 2212 gcaccagcctcgatgtacttcttagcgttatcccaggcacc 2172
to top
>gb|AF367446.1| Prunus persica clone Vp1 vacuolar H+-pyrophosphatase (vp1) mRNA,
            complete cds
          Length = 2619

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccacc 418
            ||||||| ||| ||||||||||||||||| ||||| ||||||||
Sbjct: 2178 gcaccagcctcaatgtacttcttagcattgtcccatgcaccacc 2135
to top
>emb|X83728.1|NTIPTVP17 N.tabacum mRNA for inorganic pyrophosphatase (TVP17 clone)
          Length = 1838

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 387  atgtacttcttagcattatcccaagcaccacc 418
            ||||||||||||||||||||||| ||||||||
Sbjct: 1416 atgtacttcttagcattatcccaggcaccacc 1385
to top
>emb|AJ557256.2|VVI557256 Vitis vinifera mRNA for vacuolar pyrophosphatase (vpp2 gene)
          Length = 2664

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 390  tacttcttagcattatcccaagcaccaccag 420
            |||||||| ||||||||||||||||||||||
Sbjct: 2078 tacttcttggcattatcccaagcaccaccag 2048
to top
>emb|AJ278019.1|LES278019 Lycopersicon esculentum partial mRNA for vacuolar-type
           H+-pyrophosphatase (vp1.1 gene)
          Length = 1335

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 378 ccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
           |||| |||||||||||||||||| || ||||| ||||||||||
Sbjct: 869 ccagcctcgatgtacttcttagcgttgtcccaggcaccaccag 827
to top
>gb|AY514019.1| Hevea brasiliensis PPase mRNA, complete cds
          Length = 2807

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||| || |||||||| ||||||||||| ||||||||||
Sbjct: 2218 gcaccagcctcaatatacttcttggcattatcccatgcaccaccag 2173
to top
>ref|XM_722505.1| Plasmodium yoelii yoelii str. 17XNL V-type H(+)-translocating
            pyrophosphatase (PY06858) partial mRNA
          Length = 2151

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 393  ttcttagcattatcccaagcaccaccagag 422
            ||||| ||||||||||||||||||||||||
Sbjct: 1934 ttctttgcattatcccaagcaccaccagag 1905
to top
>ref|XM_734957.1| Plasmodium chabaudi chabaudi V-type H(+)-translocating
           pyrophosphatase (PC000445.03.0) partial mRNA
          Length = 1185

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 393 ttcttagcattatcccaagcaccaccagag 422
           ||||| ||||||||||||||||||||||||
Sbjct: 968 ttctttgcattatcccaagcaccaccagag 939
to top
>gb|AC151744.23| Medicago truncatula clone mth2-32k10, complete sequence
          Length = 110897

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                               
Query: 387   atgtacttcttagcattatcccaagcaccaccag 420
             ||||||||||| ||||||||||||||||| ||||
Sbjct: 43174 atgtacttcttggcattatcccaagcaccgccag 43141
to top
>gb|DQ443731.1| Chenopodium glaucum vacuolar H+-pyrophosphatase (CVP1) mRNA, complete
            cds
          Length = 2718

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 2093 gcaccagcctcaatgtatttcttggcattgtcccaagcaccaccag 2048
to top
>gb|AF533336.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) mRNA,
            complete cds
          Length = 2695

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||| ||||| ||||| ||||| ||||||||||||||||
Sbjct: 2175 gcaccagcctcaatgtatttcttggcattgtcccaagcaccaccag 2130
to top
>gb|AE011990.1| Xanthomonas axonopodis pv. citri str. 306,  section 368 of 469 of the
            complete genome
          Length = 12292

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                        
Query: 291  ggccccgccgtgtctttgaatggatctccaaccgtatcaccagtaattgcagccttgtga 350
            |||||||| ||||||||| |||| || || || || || || ||||| ||||||||||| 
Sbjct: 5182 ggccccgcggtgtctttgtatgggtcaccgactgtgtcgccggtaatcgcagccttgtgc 5123

                          
Query: 351  gcctcactgccttt 364
            ||||| ||||||||
Sbjct: 5122 gcctcgctgccttt 5109
to top
>dbj|AB097115.1| Pyrus communis PVP3 mRNA for vacuolar proton-inorganic
            pyrophosphatase, complete cds
          Length = 2625

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 387  atgtacttcttagcattatcccaagcaccaccag 420
            ||||||||||||||||| ||||| ||||||||||
Sbjct: 2157 atgtacttcttagcattgtcccatgcaccaccag 2124
to top
>gb|AY458638.2| Uncultured bacterium 441 clone EBAC080-L31C11 genomic sequence
          Length = 19060

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 396  ttagcattatcccaagcaccaccag 420
            |||||||||||||||||||||||||
Sbjct: 6329 ttagcattatcccaagcaccaccag 6353
to top
>ref|XM_671151.1| Plasmodium berghei strain ANKA V-type H(+)-translocating
            pyrophosphatase (PB001147.00.0) partial mRNA
          Length = 2151

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 393  ttcttagcattatcccaagcaccaccaga 421
            ||||| |||||||||||||||||||||||
Sbjct: 1934 ttctttgcattatcccaagcaccaccaga 1906
to top
>gb|AY103622.1| Zea mays PCO084888 mRNA sequence
          Length = 2801

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||||| ||| ||||||||||||||||| ||||| |||||
Sbjct: 2180 gcaccagcctcaatgtacttcttagcattgtcccatgcacc 2140
to top
>dbj|AB009077.1| Vigna radiata mRNA for proton pyrophosphatase, complete cds
          Length = 2531

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcacc 415
            ||||||| ||| ||||||||||| ||||||||||| |||||
Sbjct: 2115 gcaccagcctcaatgtacttctttgcattatcccatgcacc 2075
to top
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                   
Query: 383     ctcgatgtacttcttagcattatcccaagcaccacc 418
               ||||||||||||||| || |||||||| ||||||||
Sbjct: 3454276 ctcgatgtacttcttggcgttatcccacgcaccacc 3454311
to top
>gb|AF367447.1| Prunus persica clone Vp2 vacuolar H+-pyrophosphatase (vp2) mRNA,
            complete cds
          Length = 2646

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccacc 418
            ||||||| ||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 2198 gcaccagcctctatgtatttctttgcattatcccatgcaccacc 2155
to top
>dbj|AK119631.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-E10, full
            insert sequence
          Length = 1674

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 374  tgcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            |||||||| ||| ||||||||||| || || ||||| ||||||||||
Sbjct: 1133 tgcaccagcctcaatgtacttctttgcgttgtcccaggcaccaccag 1087
to top
>dbj|AK099807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H04, full
            insert sequence
          Length = 3197

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 374  tgcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            |||||||| ||| ||||||||||| || || ||||| ||||||||||
Sbjct: 2206 tgcaccagcctcaatgtacttctttgcgttgtcccaggcaccaccag 2160
to top
>gb|U31467.1|VRU31467 Vigna radiata pyrophosphatase mRNA, complete cds
          Length = 2522

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 375  gcaccagtctcgatgtacttcttagcattatccca 409
            ||||||| ||| ||||||||||| |||||||||||
Sbjct: 2122 gcaccagcctcaatgtacttctttgcattatccca 2088
to top
>dbj|D45383.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds
          Length = 2742

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 374  tgcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            |||||||| ||| ||||||||||| || || ||||| ||||||||||
Sbjct: 2182 tgcaccagcctcaatgtacttctttgcgttgtcccaggcaccaccag 2136
to top
>ref|XM_476313.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2304

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||| ||||||||||| || |||||||| || |||||||
Sbjct: 2105 gcaccagcctcaatgtacttctttgcgttatcccatgcgccaccag 2060
to top
>gb|AF533337.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) precursor
            RNA, intron and complete cds
          Length = 2898

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 387  atgtacttcttagcattatcccaagcaccaccag 420
            ||||| ||||| ||||| ||||||||||||||||
Sbjct: 2163 atgtatttcttggcattgtcccaagcaccaccag 2130
to top
>gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete genome
          Length = 1308759

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 390     tacttcttagcattatcccaagcaccacca 419
               ||||| || |||||||||||||||||||||
Sbjct: 1011733 tacttttttgcattatcccaagcaccacca 1011762
to top
>dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F19, full
            insert sequence
          Length = 2738

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||| ||||||||||| || |||||||| || |||||||
Sbjct: 2214 gcaccagcctcaatgtacttctttgcgttatcccatgcgccaccag 2169
to top
>dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds
          Length = 2710

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 375  gcaccagtctcgatgtacttcttagcattatcccaagcaccaccag 420
            ||||||| ||| ||||||||||| || |||||||| || |||||||
Sbjct: 2199 gcaccagcctcaatgtacttctttgcgttatcccatgcgccaccag 2154
to top
>dbj|D88820.1| Acetabularia mediterranea mRNA for inorganic pyrophosphatase,
            complete cds
          Length = 3104

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 303  tctttgaatggatctccaaccgtatcacca 332
            |||||||||||||| ||||| |||||||||
Sbjct: 2881 tctttgaatggatcaccaacggtatcacca 2852
to top
>emb|AL355986.7| Human DNA sequence from clone RP11-516G5 on chromosome 13, complete
             sequence
          Length = 87831

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 105   cctttcaatgtggcaaaacaatactaaaa 133
             ||||||||||||||| ||||||| |||||
Sbjct: 72605 cctttcaatgtggcataacaatattaaaa 72577
to top
>gb|AC119677.2| Homo sapiens chromosome 1 clone RP5-1066H13, complete sequence
          Length = 170397

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   cccaagcaccaccagaggtgt 426
             |||||||||||||||||||||
Sbjct: 61157 cccaagcaccaccagaggtgt 61137
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 384     tcgatgtacttcttagcattatcccaagc 412
               |||||||||||||| || |||||||||||
Sbjct: 2554989 tcgatgtacttcttggcgttatcccaagc 2554961
to top
>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                            
Query: 284     gatcgaaggccccgccgtgtctttgaatggatctccaaccgtatc 328
               ||||||||| || || ||||| |||||||||||||| || |||||
Sbjct: 5138620 gatcgaagggccggcggtgtccttgaatggatctcccacggtatc 5138576
to top
>emb|BX571676.5| Zebrafish DNA sequence from clone DKEY-242N5 in linkage group 17,
            complete sequence
          Length = 44074

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 361  ctttaccaccaagtgcaccag 381
            |||||||||||||||||||||
Sbjct: 9535 ctttaccaccaagtgcaccag 9515
to top
>gb|AY255181.1| Hordeum brevisubulatum vacuolar proton-inorganic pyrophosphatase
            (AVP1) mRNA, complete cds
          Length = 2777

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                         
Query: 374  tgcaccagtctcgatgtacttcttagcattatcccaagcaccacc 418
            |||||||| ||| ||||||||||| || || ||||| ||||||||
Sbjct: 2162 tgcaccagcctcaatgtacttcttggcgttgtcccaggcaccacc 2118
to top
>gb|AF009568.1|AF009568 Gossypium hirsutum H+-pyrophosphatase (VPP) mRNA, partial cds
          Length = 568

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 375 gcaccagtctcgatgtacttcttagcattatcccaagcacc 415
           ||||||| ||| || || ||||| |||||||||||||||||
Sbjct: 504 gcaccagcctcaatatatttcttggcattatcccaagcacc 464
to top
>gb|AC157991.5| Mus musculus chromosome 18, clone RP23-335B10, complete sequence
          Length = 198636

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      tctgtcacagcatatatatt 26
              ||||||||||||||||||||
Sbjct: 190345 tctgtcacagcatatatatt 190364
to top
>gb|AC102155.10| Mus musculus chromosome 18, clone RP23-334J12, complete sequence
          Length = 189666

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      tctgtcacagcatatatatt 26
              ||||||||||||||||||||
Sbjct: 108288 tctgtcacagcatatatatt 108269
to top
>gb|AC116130.15| Mus musculus chromosome 17, clone RP23-98F21, complete sequence
          Length = 228842

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 357    ctgcctttaccaccaagtgc 376
              ||||||||||||||||||||
Sbjct: 126443 ctgcctttaccaccaagtgc 126462
to top
>gb|AC153972.6| Mus musculus 10 BAC RP24-383P4 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 182933

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 355    cactgcctttaccaccaagt 374
              ||||||||||||||||||||
Sbjct: 174810 cactgcctttaccaccaagt 174829
to top
>gb|AC132608.2| Mus musculus BAC clone RP23-451E12 from chromosome 18, complete sequence
          Length = 201478

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      tctgtcacagcatatatatt 26
              ||||||||||||||||||||
Sbjct: 185109 tctgtcacagcatatatatt 185090
to top
>emb|AJ843206.1| Cryptosporidium parvum partial vppI gene for proton-translocating
           inorganic pyrophosphatase
          Length = 555

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 399 gcattatcccaagcaccacc 418
           ||||||||||||||||||||
Sbjct: 554 gcattatcccaagcaccacc 535
to top
>ref|XM_741135.1| Plasmodium chabaudi chabaudi vacuolar-type H+-translocating inorganic
            pyrophosphatase, (PC000015.02.0) partial mRNA
          Length = 2793

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 393  ttcttagcattatcccaagcaccaccag 420
            ||||| |||||||||||||| |||||||
Sbjct: 2594 ttctttgcattatcccaagctccaccag 2567
to top
>ref|XM_674568.1| Plasmodium berghei strain ANKA vacuolar-type H+-translocating
            inorganic pyrophosphatase (PB000992.02.0) partial mRNA
          Length = 2880

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 393  ttcttagcattatcccaagcaccaccag 420
            ||||| |||||||||||||| |||||||
Sbjct: 2675 ttctttgcattatcccaagccccaccag 2648
to top
>emb|AL118511.25|HSDJ858B6 Human DNA sequence from clone RP5-858B6 on chromosome 1q42.13-43
             Contains two novel genes, the gene for a novel protein
             (FLJ14525) and a CpG island, complete sequence
          Length = 90175

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 83    aaatgggcagcactgaacctctcc 106
             ||||||||||||||||| ||||||
Sbjct: 52715 aaatgggcagcactgaatctctcc 52738
to top
>emb|AL031687.17|HS998H6 Human DNA sequence from clone RP5-998H6 on chromosome 20q13.1 Contains
             the CDH22 gene for cadherin-like 22, a novel gene and two
             CpG islands, complete sequence
          Length = 147815

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 325   tatcaccagtaattgcagcc 344
             ||||||||||||||||||||
Sbjct: 66314 tatcaccagtaattgcagcc 66295
to top
>dbj|AP007170.1| Aspergillus oryzae RIB40 genomic DNA, SC138
          Length = 504369

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 285    atcgaaggccccgccgtgtctttg 308
              |||||||||||| |||||||||||
Sbjct: 171830 atcgaaggcccctccgtgtctttg 171807
to top
>gb|AC016657.5| Homo sapiens chromosome 5 clone RP1-6C3, complete sequence
          Length = 128447

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    gaacctctcctttcaatgtggcaa 120
             |||||||||||| |||||||||||
Sbjct: 26612 gaacctctccttgcaatgtggcaa 26589
to top
>gb|AC159504.5| Mus musculus 10 BAC RP23-302J6 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 201259

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 355   cactgcctttaccaccaagt 374
             ||||||||||||||||||||
Sbjct: 64673 cactgcctttaccaccaagt 64692
to top
>gb|AF532114.1| Mus musculus strain 129/SvJ BAC clone citb544e14 from the MHC region,
              complete sequence
          Length = 153869

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 357    ctgcctttaccaccaagtgc 376
              ||||||||||||||||||||
Sbjct: 101412 ctgcctttaccaccaagtgc 101393
to top
>gb|AC069275.3|AC069275 Homo sapiens chromosome 3 clone RP11-194C9 map 3p, complete sequence
          Length = 151142

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tgtcacagcatatatattct 28
             ||||||||||||||||||||
Sbjct: 91041 tgtcacagcatatatattct 91060
to top
>gb|AC023472.4|AC023472 Homo sapiens chromosome 3 clone RP11-156B21 map 3p, complete sequence
          Length = 167220

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tgtcacagcatatatattct 28
             ||||||||||||||||||||
Sbjct: 54326 tgtcacagcatatatattct 54345
to top
>dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane proton-translocating
            inorganic pyrophosphatase, complete cds
          Length = 2649

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 383  ctcgatgtacttcttagcattatcccaagcaccacc 418
            ||||||||||||||| || || ||||| ||||||||
Sbjct: 2106 ctcgatgtacttctttgcgttgtcccatgcaccacc 2071
to top
>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence
          Length = 180886

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 337    ttgcagccttgtgagcctca 356
              ||||||||||||||||||||
Sbjct: 127489 ttgcagccttgtgagcctca 127508
to top
>gb|AC069276.4| Homo sapiens chromosome 3 clone RP11-470E10 map 3p, complete sequence
          Length = 184058

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     tgtcacagcatatatattct 28
             ||||||||||||||||||||
Sbjct: 11455 tgtcacagcatatatattct 11436
to top
>gb|AC018832.5| Homo sapiens chromosome 3 clone RP11-481O7 map 3p, complete sequence
          Length = 185496

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tgtcacagcatatatattct 28
             ||||||||||||||||||||
Sbjct: 19991 tgtcacagcatatatattct 20010
to top
>dbj|AB018529.1| Chara corallina CPP1 mRNA for vacuolar H+-pyrophosphatase, complete
            cds
          Length = 2839

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 383  ctcgatgtacttcttagcattatcccaagcaccacc 418
            ||||||||||||||| ||||| ||||| || |||||
Sbjct: 2387 ctcgatgtacttctttgcattgtcccaggctccacc 2352


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,224,143
Number of Sequences: 3902068
Number of extensions: 3224143
Number of successful extensions: 58544
Number of sequences better than 10.0: 78
Number of HSP's better than 10.0 without gapping: 78
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58400
Number of HSP's gapped (non-prelim): 144
length of query: 427
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 405
effective length of database: 17,147,199,772
effective search space: 6944615907660
effective search space used: 6944615907660
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top