ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl42b10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC092779.5| Oryza sativa chromosome 3 BAC OSJNBb0024N19 genom... 64 4e-07
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 64 4e-07
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
4gb|AC022448.7| Homo sapiens chromosome 5 clone RP11-78G3, comple... 46 0.083
5gb|AC137672.2| Homo sapiens chromosome 3 clone RP11-72I12, compl... 44 0.33
6gb|AY373332.2| Uncultured bacterium clone Dpcom138 16S ribosomal... 42 1.3
7gb|AC157349.7| Medicago truncatula clone mth2-139l1, complete se... 42 1.3
8gb|DQ311147.1| Bombyx mori coiled-coil domain containing 25 prot... 42 1.3
9emb|CR955034.5| Wallaby DNA sequence from clone GRWB-130P10, com... 40 5.1
10gb|AC161864.9| Medicago truncatula clone mth2-69d21, complete se... 40 5.1
11emb|Z68871.2|HSU157D4 Human DNA sequence from clone LL0XNC01-157... 40 5.1
12emb|AL138789.12| Human DNA sequence from clone RP4-694A7 on chro... 40 5.1
13gb|AC115111.2| Homo sapiens BAC clone RP11-286J9 from 4, complet... 40 5.1
14dbj|AP001307.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 5.1
15gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complet... 40 5.1

>gb|AC092779.5| Oryza sativa chromosome 3 BAC OSJNBb0024N19 genomic sequence, complete
             sequence
          Length = 121849

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                 
Query: 26    aactatgatcttcgttgcaatttacaacatgccgaagattgaaatgaacgac 77
             ||||||||||||| ||||||||||||| | |  |||||||||||||||||||
Sbjct: 95390 aactatgatcttctttgcaatttacaatacggtgaagattgaaatgaacgac 95339



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                    
Query: 26       aactatgatcttcgttgcaatttacaacatgccgaagattgaaatgaacgac 77
                ||||||||||||| ||||||||||||| | |  |||||||||||||||||||
Sbjct: 27083501 aactatgatcttctttgcaatttacaatacggtgaagattgaaatgaacgac 27083552



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                    
Query: 26       aactatgatcttcgttgcaatttacaacatgccgaagattgaaatgaacgac 77
                ||||||||||||| ||||||||||||| | |  |||||||||||||||||||
Sbjct: 27174824 aactatgatcttctttgcaatttacaatacggtgaagattgaaatgaacgac 27174875



to top

>gb|AC022448.7| Homo sapiens chromosome 5 clone RP11-78G3, complete sequence
          Length = 111000

 Score = 46.1 bits (23), Expect = 0.083
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 311   atttgatttggtagaagtaaaag 333
             |||||||||||||||||||||||
Sbjct: 15215 atttgatttggtagaagtaaaag 15193



to top

>gb|AC137672.2| Homo sapiens chromosome 3 clone RP11-72I12, complete sequence
          Length = 150313

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 309   agatttgatttggtagaagtaa 330
             ||||||||||||||||||||||
Sbjct: 90363 agatttgatttggtagaagtaa 90342



to top

>gb|AY373332.2| Uncultured bacterium clone Dpcom138 16S ribosomal RNA gene, partial
           sequence
          Length = 670

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 318 ttggtagaagtaaaagccatg 338
           |||||||||||||||||||||
Sbjct: 133 ttggtagaagtaaaagccatg 153



to top

>gb|AC157349.7| Medicago truncatula clone mth2-139l1, complete sequence
          Length = 116909

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 311   atttgatttggtagaagtaaa 331
             |||||||||||||||||||||
Sbjct: 70240 atttgatttggtagaagtaaa 70260



to top

>gb|DQ311147.1| Bombyx mori coiled-coil domain containing 25 protein mRNA, complete
            cds
          Length = 1851

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 268  aaaaaatatgaaacagatcta 288
            |||||||||||||||||||||
Sbjct: 1124 aaaaaatatgaaacagatcta 1104



to top

>emb|CR955034.5| Wallaby DNA sequence from clone GRWB-130P10, complete sequence
          Length = 176287

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 309    agatttgatttggtagaagt 328
              ||||||||||||||||||||
Sbjct: 145656 agatttgatttggtagaagt 145675



to top

>gb|AC161864.9| Medicago truncatula clone mth2-69d21, complete sequence
          Length = 133324

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    ttgaaatgaacgacccaaat 83
             ||||||||||||||||||||
Sbjct: 60324 ttgaaatgaacgacccaaat 60343



to top

>emb|Z68871.2|HSU157D4 Human DNA sequence from clone LL0XNC01-157D4 on chromosome X Contains
            the 3' end of a novel gene and the 5' end of a novel
            gene, complete sequence
          Length = 37899

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 265  aacaaaaaatatgaaacaga 284
            ||||||||||||||||||||
Sbjct: 3566 aacaaaaaatatgaaacaga 3585



to top

>emb|AL138789.12| Human DNA sequence from clone RP4-694A7 on chromosome 1p31.2-32.1
             Contains the 3' end of the gene for cell cycle control
             protein SDP35 (SDP35), two novel genes and a thioredoxin
             (TXN) pseudogene, complete sequence
          Length = 96157

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 52    acatgccgaagattgaaatg 71
             ||||||||||||||||||||
Sbjct: 77890 acatgccgaagattgaaatg 77871



to top

>gb|AC115111.2| Homo sapiens BAC clone RP11-286J9 from 4, complete sequence
          Length = 113684

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 265  aacaaaaaatatgaaacaga 284
            ||||||||||||||||||||
Sbjct: 7563 aacaaaaaatatgaaacaga 7582



to top

>dbj|AP001307.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMM17
          Length = 80733

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   gcattgcaaatataaaattt 202
             ||||||||||||||||||||
Sbjct: 39794 gcattgcaaatataaaattt 39813



to top

>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence
          Length = 180886

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 186    ttgcaaatataaaatttgac 205
              ||||||||||||||||||||
Sbjct: 137418 ttgcaaatataaaatttgac 137399


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,037,234
Number of Sequences: 3902068
Number of extensions: 4037234
Number of successful extensions: 76913
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76815
Number of HSP's gapped (non-prelim): 98
length of query: 383
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 361
effective length of database: 17,147,199,772
effective search space: 6190139117692
effective search space used: 6190139117692
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top