>gb|AC130528.4| Mus musculus BAC clone RP23-122M14 from chromosome 6, complete sequence
          Length = 208738

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 44    gaaacaggtacagaaagacta 64
             |||||||||||||||||||||
Sbjct: 65572 gaaacaggtacagaaagacta 65552

>gb|AF039044.1| Caenorhabditis elegans cosmid F48G7, complete sequence
          Length = 31549

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tgtgttgtgtcaaaagaaaaa 231
             |||||||||||||||||||||
Sbjct: 25190 tgtgttgtgtcaaaagaaaaa 25210

>ref|NM_070874.1| Caenorhabditis elegans Serpentine Receptor, class J family member
           (srj-37) (srj-37) mRNA, complete cds
          Length = 1002

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 tgtgttgtgtcaaaagaaaaa 231
           |||||||||||||||||||||
Sbjct: 927 tgtgttgtgtcaaaagaaaaa 947

>gb|AC011894.3| Homo sapiens BAC clone RP11-52M17 from 7, complete sequence
          Length = 24310

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 94   ttgcttgaatctacaaggca 113
            ||||||||||||||||||||
Sbjct: 8675 ttgcttgaatctacaaggca 8656

>emb|AL353637.21| Human DNA sequence from clone RP11-159H20 on chromosome 9q21.12-21.32
            Contains a DnaJ (Hsp40) homolog subfamily B member 5
            (DNAJB5) pseudogene, a lysophospholipase II (LYPLA2)
            pseudogene, an eukaryotic translation initiation factor 3
            subunit 1 35kDa (EIF3S1) pseudogene, the gene (possible
            pseudogene) for a novel protein similar to forkhead box
            B1 (FOXB1), ATP synthase H+ transporting mitochondrial F0
            complex subunit f isoform 2 (ATP5J2) pseudogene and three
            CpG islands, complete sequence
          Length = 146466

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 94   ttgcttgaatctacaaggca 113
            ||||||||||||||||||||
Sbjct: 6938 ttgcttgaatctacaaggca 6957

>gb|AF007270.1|F2P16 Arabidopsis thaliana BAC F2P16, complete sequence
          Length = 110946

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   tgttgtgtcaaaagaaaaac 232
             ||||||||||||||||||||
Sbjct: 42575 tgttgtgtcaaaagaaaaac 42556

>gb|AC146064.4| Pan troglodytes BAC clone RP43-59B14 from chromosome 7, complete sequence
          Length = 186687

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 94     ttgcttgaatctacaaggca 113
              ||||||||||||||||||||
Sbjct: 134992 ttgcttgaatctacaaggca 135011


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,017,392
Number of Sequences: 3902068
Number of extensions: 2017392
Number of successful extensions: 32695
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32686
Number of HSP's gapped (non-prelim): 9
length of query: 232
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 210
effective length of database: 17,147,199,772
effective search space: 3600911952120
effective search space used: 3600911952120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)