>gb|AC102686.7| Mus musculus chromosome 1, clone RP24-467J24, complete sequence
          Length = 156547

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 11    acacttattatatagaaggttca 33
             |||||||||||||||||| ||||
Sbjct: 84684 acacttattatatagaagattca 84662

>gb|AE006100.1| Pasteurella multocida subsp. multocida str. Pm70 section 67 of 204 of
            the complete genome
          Length = 13317

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 29   gttcatgatgcattctaca 47
            |||||||||||||||||||
Sbjct: 5080 gttcatgatgcattctaca 5062

>gb|AE006850.1| Sulfolobus solfataricus P2 section 209 of 272 of the complete genome
          Length = 10755

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 2    agcattccaacacttatta 20
            |||||||||||||||||||
Sbjct: 5635 agcattccaacacttatta 5617

>gb|AC138642.10| Mus musculus chromosome 3, clone RP23-21O7, complete sequence
          Length = 252108

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 15     ttattatatagaaggttcatgat 37
              |||||||||| ||||||||||||
Sbjct: 153873 ttattatataaaaggttcatgat 153851

>gb|AC006044.2| Homo sapiens BAC clone RP11-539B24 from 7, complete sequence
          Length = 141509

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 9     caacacttattatatagaa 27
             |||||||||||||||||||
Sbjct: 72053 caacacttattatatagaa 72071

>emb|AL358073.24| Human DNA sequence from clone RP11-458I7 on chromosome 1 Contains the
             5' end of the ZA20D1 gene for zinc finger, A20 domain
             containing 1, a ribosomal protein L6 (RPL6) pseudogene,
             the VPS45A gene for vacuolar protein sorting 45A (yeast),
             the gene for CK2 interacting protein 1; HQ0024c protein
             (CKIP-1), a novel gene and a CpG island, complete sequence
          Length = 188211

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 5     attccaacacttattatatagaa 27
             ||||||| |||||||||||||||
Sbjct: 53879 attccaagacttattatatagaa 53857

>emb|AL162580.20| Human DNA sequence from clone RP11-524A17 on chromosome 6 Contains a
              novel gene and a protein phosphatase 1 regulatory
              (inhibitor) subunit 14A (PPP1R14A) pseudogene, complete
              sequence
          Length = 171483

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 34     tgatgcattctacaatatg 52
              |||||||||||||||||||
Sbjct: 120902 tgatgcattctacaatatg 120920

>gb|AC099525.5| Papio anubis clone RP41-277O17, complete sequence
          Length = 163567

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 9     caacacttattatatagaa 27
             |||||||||||||||||||
Sbjct: 48481 caacacttattatatagaa 48499

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
              hansenii
          Length = 2336804

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 4      cattccaacacttattata 22
              |||||||||||||||||||
Sbjct: 924595 cattccaacacttattata 924577

>gb|AC008674.5| Homo sapiens chromosome 5 clone CTB-43E15, complete sequence
          Length = 178502

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 36     atgcattctacaatatgct 54
              |||||||||||||||||||
Sbjct: 142221 atgcattctacaatatgct 142203

>gb|AC010339.8|AC010339 Homo sapiens chromosome 5 clone CTD-2009A17, complete sequence
          Length = 122480

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 36    atgcattctacaatatgct 54
             |||||||||||||||||||
Sbjct: 32155 atgcattctacaatatgct 32137

>gb|AC020559.4|AC020559 Homo sapiens BAC clone RP11-527F13 from 6, complete sequence
          Length = 194079

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 34    tgatgcattctacaatatg 52
             |||||||||||||||||||
Sbjct: 43269 tgatgcattctacaatatg 43287

>emb|AJ296029.1|SSO296029 Sulfolobus solfataricus celS gene for cellulase
          Length = 1117

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 2   agcattccaacacttatta 20
           |||||||||||||||||||
Sbjct: 797 agcattccaacacttatta 815

>emb|BX511139.4| Mouse DNA sequence from clone RP24-262M23 on chromosome 11, complete
             sequence
          Length = 105948

 Score = 38.2 bits (19), Expect = 5.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 31    tcatgatgcattctacaat 49
             |||||||||||||||||||
Sbjct: 27493 tcatgatgcattctacaat 27475


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 733,660
Number of Sequences: 3902068
Number of extensions: 733660
Number of successful extensions: 46279
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46253
Number of HSP's gapped (non-prelim): 26
length of query: 127
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 106
effective length of database: 17,151,101,840
effective search space: 1818016795040
effective search space used: 1818016795040
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)