>gb|AC139569.3| Mus musculus BAC clone RP24-340F13 from chromosome 14, complete sequence
          Length = 173736

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 136    agcaaaacaaaaggatgtaaaca 158
              |||||||||||||||||||||||
Sbjct: 122474 agcaaaacaaaaggatgtaaaca 122452

>gb|AC162183.4| Mus musculus BAC clone RP23-27I10 from chromosome 14, complete
            sequence
          Length = 225212

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 136  agcaaaacaaaaggatgtaaaca 158
            |||||||||||||||||||||||
Sbjct: 5297 agcaaaacaaaaggatgtaaaca 5275

>gb|AY491010.1| Leishmania major Hut1L protein (Hut1L) gene, complete cds
          Length = 1732

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 215 taacgcgcgcggtaccacaca 235
           |||||||||||||||||||||
Sbjct: 675 taacgcgcgcggtaccacaca 655

>gb|AC040975.8| Homo sapiens chromosome 8, clone RP11-662B19, complete sequence
          Length = 199112

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 266   atttaaacctgttgtttttct 286
             |||||||||||||||||||||
Sbjct: 47832 atttaaacctgttgtttttct 47812

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     cagcagtatggatgtaccgt 41
              ||||||||||||||||||||
Sbjct: 938827 cagcagtatggatgtaccgt 938846

>gb|AC121797.3| Mus musculus BAC clone RP23-424C23 from chromosome 3, complete sequence
          Length = 177109

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    tgggtacagttctttattgg 87
             ||||||||||||||||||||
Sbjct: 61035 tgggtacagttctttattgg 61016

>gb|AF506853.1| Papaya ringspot virus isolate VNW-38 coat protein (cp) gene,
           partial cds
          Length = 849

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 140 aaacaaaaggatgtaaacaa 159
           ||||||||||||||||||||
Sbjct: 64  aaacaaaaggatgtaaacaa 83

>emb|CT010516.6| Mouse DNA sequence from clone RP23-276H24 on chromosome 14, complete
             sequence
          Length = 194815

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 5     gaatcatatgcaaggcacagcagt 28
             ||||||||||||| ||||||||||
Sbjct: 45930 gaatcatatgcaatgcacagcagt 45907

>dbj|AB023293.1| Bacillus thuringiensis gene for 94kDa mosquitocidal toxin, complete
            cds
          Length = 3190

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 260  gctgtaatttaaacctgttg 279
            ||||||||||||||||||||
Sbjct: 1905 gctgtaatttaaacctgttg 1886


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,141,241
Number of Sequences: 3902068
Number of extensions: 3141241
Number of successful extensions: 47037
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47014
Number of HSP's gapped (non-prelim): 23
length of query: 291
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 269
effective length of database: 17,147,199,772
effective search space: 4612596738668
effective search space used: 4612596738668
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)