ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl41g08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 244 2e-61
2dbj|AK119540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 2e-61
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 244 2e-61
4emb|AL731747.2|CNS08C7W Oryza sativa chromosome 12, . BAC OSJNBa... 244 2e-61
5dbj|AK067367.1| Oryza sativa (japonica cultivar-group) cDNA clon... 236 5e-59
6dbj|AK062059.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 3e-48
7gb|AY109575.1| Zea mays CL1708_1 mRNA sequence 151 2e-33
8ref|NM_001036666.1| Arabidopsis thaliana EMB2726; RNA binding / ... 46 0.093
9ref|NM_119050.2| Arabidopsis thaliana EMB2726; RNA binding / str... 46 0.093
10gb|AY661462.1| Arabidopsis thaliana chloroplast polyprotein of e... 46 0.093
11emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, ... 46 0.093
12emb|AL078469.2|ATF25O24 Arabidopsis thaliana DNA chromosome 4, B... 46 0.093
13emb|AL078470.1|ATF19B15 Arabidopsis thaliana DNA chromosome 4, B... 46 0.093
14gb|AY056792.1| Arabidopsis thaliana AT4g29060/F19B15_90 mRNA, co... 46 0.093
15emb|BX828821.1|CNS0A2AV Arabidopsis thaliana Full-length cDNA Co... 46 0.093
16gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complet... 44 0.37
17dbj|BS000097.1| Pan troglodytes chromosome 22 clone:RP43-016D07,... 44 0.37
18gb|AF512506.1| Morone saxatilis class IIIB myosin short isoform ... 42 1.4
19gb|AC174772.1| Gasterosteus aculeatus clone VMRC28-84K14, comple... 42 1.4
20gb|AC146967.3| Bos taurus clone RP42-279M12, complete sequence 40 5.7
21gb|AC104514.2| Drosophila melanogaster clone BACR22L21, complete... 40 5.7
22gb|AC182645.3| Pan troglodytes BAC clone CH251-7F19 from chromos... 40 5.7
23gb|AY661656.1| Sorghum bicolor clone BAC 88M4, complete sequence 40 5.7
24gb|AY603485.1| Exostoma labiatum ribosomal protein S7 (rpS7) gen... 40 5.7
25gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 40 5.7
26gb|DP000008.1| Bos taurus target 1 genomic scaffold 40 5.7
27gb|AC115361.5| Mus musculus BAC clone RP24-76P12 from chromosome... 40 5.7
28emb|AL603703.10| Human DNA sequence from clone RP11-773D16 on ch... 40 5.7
29emb|AL355334.26| Human DNA sequence from clone RP11-399L7 on chr... 40 5.7
30emb|AL157893.16| Human DNA sequence from clone RP11-322M19 on ch... 40 5.7
31emb|X83598.1|TTRTP T.thermophilus rpsB, tsf and pyrH genes 40 5.7
32emb|BX897699.1| Bartonella henselae strain Houston-1, complete g... 40 5.7
33gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, compl... 40 5.7
34gb|AC093294.3| Homo sapiens chromosome 5 clone RP11-524C16, comp... 40 5.7
35gb|AC060765.5|AC060765 Homo sapiens chromosome 8, clone RP11-653... 40 5.7
36gb|AF130084.1|AF130084 Homo sapiens clone FLB8310 PRO2225 mRNA, ... 40 5.7
37gb|AC091500.1|AC091500 Drosophila melanogaster, chromosome 2R, r... 40 5.7
38dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
39gb|AF244565.1|AF244565 Takakia lepidozioides ribulose-bisphospha... 40 5.7
40dbj|AP001633.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.7
41dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 5.7
42emb|BX005447.8| Zebrafish DNA sequence from clone DKEY-29B14, co... 40 5.7
43emb|BX088551.7| Zebrafish DNA sequence from clone CH211-106A19 i... 40 5.7
44gb|AC153868.3| Mus musculus BAC RP23-384D16 (Roswell Park Cancer... 40 5.7
45gb|AC153578.4| Mus musculus 6 BAC RP23-218P2 (Roswell Park Cance... 40 5.7
46gb|U50042.1|DDU50042 Dictyostelium discoideum repE homolog of UV... 40 5.7
47gb|AE003801.4| Drosophila melanogaster chromosome 2R, section 49... 40 5.7
48gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 5.7
49gb|AC004640.1|AC004640 Drosophila melanogaster DNA sequence (P1s... 40 5.7
50gb|AC122284.5| Mus musculus BAC clone RP23-246A5 from 6, complet... 40 5.7
51gb|AC142414.3| Mus musculus BAC clone RP23-372N15 from 8, comple... 40 5.7
52emb|AL806516.4| Mouse DNA sequence from clone RP23-453N20 on chr... 40 5.7
53dbj|AB238686.1| Thiobacillus thioparus scnC, orf1, orf2, orf3, o... 40 5.7
54emb|AL132656.15|HSA119F19 Human DNA sequence from clone RP11-119... 40 5.7

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  244 bits (123), Expect = 2e-61
 Identities = 156/167 (93%)
 Strand = Plus / Minus

                                                                            
Query: 258      aacctccgtaccttgatgttctcccccagaccagcgatcgtctccttcacgagatccttc 317
                |||||||||||||||||||||||||| ||    ||||||||||||||||| |||||||||
Sbjct: 21699747 aacctccgtaccttgatgttctccccaagggtggcgatcgtctccttcacaagatccttc 21699688

                                                                            
Query: 318      accgtcttgctgtcatccttgatgaagggctgctccaggagggccatcacgccgagcctc 377
                |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 21699687 accgtcttgctgtcatccttgatgaaaggctgctccaggagggccagcacgccgagcctc 21699628

                                                               
Query: 378      ttcgatatccgcccttccacgatcttctccctgatgttctcgggttt 424
                ||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 21699627 ttcgatatccggccttcgacgatcttctccctgatgttctcaggttt 21699581



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                                  
Query: 167      atgaatcaaaatgtgcccaactcctgatgtcagg 200
                |||||||||||| |||||||||||||||||||||
Sbjct: 21699835 atgaatcaaaatatgcccaactcctgatgtcagg 21699802



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 24       atattgatctctcttgtcatctaca 48
                |||||||||||||||||||||||||
Sbjct: 21699993 atattgatctctcttgtcatctaca 21699969



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 328      tgtcatccttgatgaagggctgctccag 355
                |||||| |||||||||||| ||||||||
Sbjct: 21698816 tgtcattcttgatgaagggttgctccag 21698789



to top

>dbj|AK119540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-C06, full
            insert sequence
          Length = 1368

 Score =  244 bits (123), Expect = 2e-61
 Identities = 156/167 (93%)
 Strand = Plus / Minus

                                                                        
Query: 258  aacctccgtaccttgatgttctcccccagaccagcgatcgtctccttcacgagatccttc 317
            |||||||||||||||||||||||||| ||    ||||||||||||||||| |||||||||
Sbjct: 1101 aacctccgtaccttgatgttctccccaagggtggcgatcgtctccttcacaagatccttc 1042

                                                                        
Query: 318  accgtcttgctgtcatccttgatgaagggctgctccaggagggccatcacgccgagcctc 377
            |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 1041 accgtcttgctgtcatccttgatgaaaggctgctccaggagggccagcacgccgagcctc 982

                                                           
Query: 378  ttcgatatccgcccttccacgatcttctccctgatgttctcgggttt 424
            ||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 981  ttcgatatccggccttcgacgatcttctccctgatgttctcaggttt 935



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 167  atgaatcaaaatgtgcccaactcctgatgtcagg 200
            |||||||||||| |||||||||||||||||||||
Sbjct: 1189 atgaatcaaaatatgcccaactcctgatgtcagg 1156



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 24   atattgatctctcttgtcatctaca 48
            |||||||||||||||||||||||||
Sbjct: 1347 atattgatctctcttgtcatctaca 1323



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 328 tgtcatccttgatgaagggctgctccag 355
           |||||| |||||||||||| ||||||||
Sbjct: 308 tgtcattcttgatgaagggttgctccag 281



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  244 bits (123), Expect = 2e-61
 Identities = 156/167 (93%)
 Strand = Plus / Minus

                                                                            
Query: 258      aacctccgtaccttgatgttctcccccagaccagcgatcgtctccttcacgagatccttc 317
                |||||||||||||||||||||||||| ||    ||||||||||||||||| |||||||||
Sbjct: 21628092 aacctccgtaccttgatgttctccccaagggtggcgatcgtctccttcacaagatccttc 21628033

                                                                            
Query: 318      accgtcttgctgtcatccttgatgaagggctgctccaggagggccatcacgccgagcctc 377
                |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 21628032 accgtcttgctgtcatccttgatgaaaggctgctccaggagggccagcacgccgagcctc 21627973

                                                               
Query: 378      ttcgatatccgcccttccacgatcttctccctgatgttctcgggttt 424
                ||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 21627972 ttcgatatccggccttcgacgatcttctccctgatgttctcaggttt 21627926



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                                  
Query: 167      atgaatcaaaatgtgcccaactcctgatgtcagg 200
                |||||||||||| |||||||||||||||||||||
Sbjct: 21628180 atgaatcaaaatatgcccaactcctgatgtcagg 21628147



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 24       atattgatctctcttgtcatctaca 48
                |||||||||||||||||||||||||
Sbjct: 21628338 atattgatctctcttgtcatctaca 21628314



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 328      tgtcatccttgatgaagggctgctccag 355
                |||||| |||||||||||| ||||||||
Sbjct: 21627161 tgtcattcttgatgaagggttgctccag 21627134



to top

>emb|AL731747.2|CNS08C7W Oryza sativa chromosome 12, . BAC OSJNBa0024C08 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 186030

 Score =  244 bits (123), Expect = 2e-61
 Identities = 156/167 (93%)
 Strand = Plus / Plus

                                                                          
Query: 258    aacctccgtaccttgatgttctcccccagaccagcgatcgtctccttcacgagatccttc 317
              |||||||||||||||||||||||||| ||    ||||||||||||||||| |||||||||
Sbjct: 112804 aacctccgtaccttgatgttctccccaagggtggcgatcgtctccttcacaagatccttc 112863

                                                                          
Query: 318    accgtcttgctgtcatccttgatgaagggctgctccaggagggccatcacgccgagcctc 377
              |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 112864 accgtcttgctgtcatccttgatgaaaggctgctccaggagggccagcacgccgagcctc 112923

                                                             
Query: 378    ttcgatatccgcccttccacgatcttctccctgatgttctcgggttt 424
              ||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 112924 ttcgatatccggccttcgacgatcttctccctgatgttctcaggttt 112970



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                                
Query: 167    atgaatcaaaatgtgcccaactcctgatgtcagg 200
              |||||||||||| |||||||||||||||||||||
Sbjct: 112716 atgaatcaaaatatgcccaactcctgatgtcagg 112749



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 24     atattgatctctcttgtcatctaca 48
              |||||||||||||||||||||||||
Sbjct: 112558 atattgatctctcttgtcatctaca 112582



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 328    tgtcatccttgatgaagggctgctccag 355
              |||||| |||||||||||| ||||||||
Sbjct: 113735 tgtcattcttgatgaagggttgctccag 113762



to top

>dbj|AK067367.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106B18, full
            insert sequence
          Length = 3861

 Score =  236 bits (119), Expect = 5e-59
 Identities = 155/167 (92%)
 Strand = Plus / Minus

                                                                        
Query: 258  aacctccgtaccttgatgttctcccccagaccagcgatcgtctccttcacgagatccttc 317
            |||||||||||||||||||||||||| ||    ||||||||||||| ||| |||||||||
Sbjct: 3594 aacctccgtaccttgatgttctccccaagggtggcgatcgtctcctccacaagatccttc 3535

                                                                        
Query: 318  accgtcttgctgtcatccttgatgaagggctgctccaggagggccatcacgccgagcctc 377
            |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 3534 accgtcttgctgtcatccttgatgaaaggctgctccaggagggccagcacgccgagcctc 3475

                                                           
Query: 378  ttcgatatccgcccttccacgatcttctccctgatgttctcgggttt 424
            ||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 3474 ttcgatatccggccttcgacgatcttctccctgatgttctcaggttt 3428



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 167  atgaatcaaaatgtgcccaactcctgatgtcagg 200
            |||||||||||| |||||||||||||||||||||
Sbjct: 3682 atgaatcaaaatatgcccaactcctgatgtcagg 3649



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 24   atattgatctctcttgtcatctaca 48
            |||||||||||||||||||||||||
Sbjct: 3840 atattgatctctcttgtcatctaca 3816



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 328  tgtcatccttgatgaagggctgctccag 355
            |||||| |||||||||||| ||||||||
Sbjct: 2801 tgtcattcttgatgaagggttgctccag 2774



to top

>dbj|AK062059.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-C08, full
           insert sequence
          Length = 404

 Score =  200 bits (101), Expect = 3e-48
 Identities = 128/137 (93%)
 Strand = Plus / Minus

                                                                       
Query: 258 aacctccgtaccttgatgttctcccccagaccagcgatcgtctccttcacgagatccttc 317
           |||||||||||||||||||||||||| ||    ||||||||||||||||| |||||||||
Sbjct: 137 aacctccgtaccttgatgttctccccaagggtggcgatcgtctccttcacaagatccttc 78

                                                                       
Query: 318 accgtcttgctgtcatccttgatgaagggctgctccaggagggccatcacgccgagcctc 377
           |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||
Sbjct: 77  accgtcttgctgtcatccttgatgaaaggctgctccaggagggccagcacgccgagcctc 18

                            
Query: 378 ttcgatatccgcccttc 394
           ||||||||||| |||||
Sbjct: 17  ttcgatatccggccttc 1



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 167 atgaatcaaaatgtgcccaactcctgatgtcagg 200
           |||||||||||| |||||||||||||||||||||
Sbjct: 225 atgaatcaaaatatgcccaactcctgatgtcagg 192



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 24  atattgatctctcttgtcatctaca 48
           |||||||||||||||||||||||||
Sbjct: 383 atattgatctctcttgtcatctaca 359



to top

>gb|AY109575.1| Zea mays CL1708_1 mRNA sequence
          Length = 2612

 Score =  151 bits (76), Expect = 2e-33
 Identities = 118/132 (89%)
 Strand = Plus / Minus

                                                                        
Query: 229  atcagttttcgccgagggtatacctgacaaacctccgtaccttgatgttctcccccagac 288
            ||||||| ||||| ||||| |||| |||||||||||| ||||| ||||||||||| ||  
Sbjct: 2362 atcagttctcgcccagggtgtaccggacaaacctccgcaccttaatgttctccccgagtg 2303

                                                                        
Query: 289  cagcgatcgtctccttcacgagatccttcaccgtcttgctgtcatccttgatgaagggct 348
              |||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||||
Sbjct: 2302 aggcgaccgtctccttcacgagatccttcaccgtcttgctgtcgtccttgatgtagggct 2243

                        
Query: 349  gctccaggaggg 360
            ||||||||||||
Sbjct: 2242 gctccaggaggg 2231



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 93   agtaacaggtgatacaaaattatacatggaaccgagt 129
            |||||||||||||||  ||||| | ||||||||||||
Sbjct: 2519 agtaacaggtgatacggaattacagatggaaccgagt 2483



to top

>ref|NM_001036666.1| Arabidopsis thaliana EMB2726; RNA binding / structural constituent of
            ribosome / translation elongation factor AT4G29060
            (EMB2726) transcript variant AT4G29060.2 mRNA, complete
            cds
          Length = 2616

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 390  ccttccacgatcttctccctgatgttctcgggttt 424
            |||||||| ||||||||||| |||||||| |||||
Sbjct: 2201 ccttccacaatcttctcccttatgttctctggttt 2167



to top

>ref|NM_119050.2| Arabidopsis thaliana EMB2726; RNA binding / structural constituent of
            ribosome / translation elongation factor AT4G29060
            (EMB2726) transcript variant AT4G29060.1 mRNA, complete
            cds
          Length = 3348

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 390  ccttccacgatcttctccctgatgttctcgggttt 424
            |||||||| ||||||||||| |||||||| |||||
Sbjct: 2933 ccttccacaatcttctcccttatgttctctggttt 2899



to top

>gb|AY661462.1| Arabidopsis thaliana chloroplast polyprotein of elongation factor Ts
            precursor, mRNA, complete cds, alternatively spliced;
            nuclear gene for chloroplast product
          Length = 2133

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 390  ccttccacgatcttctccctgatgttctcgggttt 424
            |||||||| ||||||||||| |||||||| |||||
Sbjct: 1970 ccttccacaatcttctcccttatgttctctggttt 1936



to top

>emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 70
          Length = 198429

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 390   ccttccacgatcttctccctgatgttctcgggttt 424
             |||||||| ||||||||||| |||||||| |||||
Sbjct: 49232 ccttccacaatcttctcccttatgttctctggttt 49198



to top

>emb|AL078469.2|ATF25O24 Arabidopsis thaliana DNA chromosome 4, BAC clone F25O24 (ESSA project)
          Length = 97714

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 390   ccttccacgatcttctccctgatgttctcgggttt 424
             |||||||| ||||||||||| |||||||| |||||
Sbjct: 74263 ccttccacaatcttctcccttatgttctctggttt 74229



to top

>emb|AL078470.1|ATF19B15 Arabidopsis thaliana DNA chromosome 4, BAC clone F19B15 (ESSA project)
          Length = 101679

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 390   ccttccacgatcttctccctgatgttctcgggttt 424
             |||||||| ||||||||||| |||||||| |||||
Sbjct: 32759 ccttccacaatcttctcccttatgttctctggttt 32725



to top

>gb|AY056792.1| Arabidopsis thaliana AT4g29060/F19B15_90 mRNA, complete cds
          Length = 3226

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 390  ccttccacgatcttctccctgatgttctcgggttt 424
            |||||||| ||||||||||| |||||||| |||||
Sbjct: 2907 ccttccacaatcttctcccttatgttctctggttt 2873



to top

>emb|BX828821.1|CNS0A2AV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL42ZA04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 390 ccttccacgatcttctccctgatgttctcgggttt 424
           |||||||| ||||||||||| |||||||| |||||
Sbjct: 657 ccttccacaatcttctcccttatgttctctggttt 623



to top

>gb|CP000141.1| Carboxydothermus hydrogenoformans Z-2901, complete genome
          Length = 2401520

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 141     caaactagcaacagctatgcat 162
               ||||||||||||||||||||||
Sbjct: 2205587 caaactagcaacagctatgcat 2205608



to top

>dbj|BS000097.1| Pan troglodytes chromosome 22 clone:RP43-016D07, map 22, complete
              sequences
          Length = 184809

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 166    gatgaatcaaaatgtgcccaac 187
              ||||||||||||||||||||||
Sbjct: 133852 gatgaatcaaaatgtgcccaac 133873



to top

>gb|AF512506.1| Morone saxatilis class IIIB myosin short isoform mRNA, complete cds
          Length = 4020

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 335 cttgatgaagggctgctccaggagg 359
           |||||||||||| ||||||||||||
Sbjct: 903 cttgatgaagggatgctccaggagg 879



to top

>gb|AC174772.1| Gasterosteus aculeatus clone VMRC28-84K14, complete sequence
          Length = 121286

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 335   cttgatgaagggctgctccaggagg 359
             |||||||||||| ||||||||||||
Sbjct: 45451 cttgatgaagggatgctccaggagg 45475



to top

>gb|AC146967.3| Bos taurus clone RP42-279M12, complete sequence
          Length = 186611

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 330    tcatccttgatgaagggctg 349
              ||||||||||||||||||||
Sbjct: 136263 tcatccttgatgaagggctg 136244



to top

>gb|AC104514.2| Drosophila melanogaster clone BACR22L21, complete sequence
          Length = 170718

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   agtacaactgagtacaaact 146
             ||||||||||||||||||||
Sbjct: 13521 agtacaactgagtacaaact 13502



to top

>gb|AC182645.3| Pan troglodytes BAC clone CH251-7F19 from chromosome 10, complete
              sequence
          Length = 221731

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     tttcatggacaatatattga 30
              ||||||||||||||||||||
Sbjct: 156055 tttcatggacaatatattga 156036



to top

>gb|AY661656.1| Sorghum bicolor clone BAC 88M4, complete sequence
          Length = 279448

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 398   gatcttctccctgatgttct 417
             ||||||||||||||||||||
Sbjct: 38394 gatcttctccctgatgttct 38413



to top

>gb|AY603485.1| Exostoma labiatum ribosomal protein S7 (rpS7) gene, exons 2, 3 and
           partial cds
          Length = 167

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 398 gatcttctccctgatgttct 417
           ||||||||||||||||||||
Sbjct: 66  gatcttctccctgatgttct 85



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 333    tccttgatgaagggctgctc 352
              ||||||||||||||||||||
Sbjct: 692770 tccttgatgaagggctgctc 692751



to top

>gb|DP000008.1| Bos taurus target 1 genomic scaffold
          Length = 2072671

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 330     tcatccttgatgaagggctg 349
               ||||||||||||||||||||
Sbjct: 2022323 tcatccttgatgaagggctg 2022304



to top

>gb|AC115361.5| Mus musculus BAC clone RP24-76P12 from chromosome 8, complete sequence
          Length = 235095

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   gtgatacaaaattatacatg 120
             ||||||||||||||||||||
Sbjct: 59225 gtgatacaaaattatacatg 59206



to top

>emb|AL603703.10| Human DNA sequence from clone RP11-773D16 on chromosome 10 Contains the
             3' end of novel gene, a novel gene and a novel pseudogene,
             complete sequence
          Length = 135183

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    tttcatggacaatatattga 30
             ||||||||||||||||||||
Sbjct: 81265 tttcatggacaatatattga 81246



to top

>emb|AL355334.26| Human DNA sequence from clone RP11-399L7 on chromosome 10 Contains the
             cathepsin L-like 1 (CTSLL1) pseudogene, a novel gene, a
             pseudogene similar to part of ring finger protein 3
             (RNF3), the 5' end of the MINPP1 gene for multiple
             inositol polyphosphate histidine phosphatase 1 and a CpG
             island, complete sequence
          Length = 173390

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    tttcatggacaatatattga 30
             ||||||||||||||||||||
Sbjct: 89569 tttcatggacaatatattga 89588



to top

>emb|AL157893.16| Human DNA sequence from clone RP11-322M19 on chromosome 10 Contains the
             gene for a novel protein highly similar to KIAA2020, two
             novel genes and a CpG island, complete sequence
          Length = 162286

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    tttcatggacaatatattga 30
             ||||||||||||||||||||
Sbjct: 78240 tttcatggacaatatattga 78221



to top

>emb|X83598.1|TTRTP T.thermophilus rpsB, tsf and pyrH genes
          Length = 1124

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 328 tgtcatccttgatgaagggctgctccag 355
           |||| ||||||| |||||||||||||||
Sbjct: 763 tgtcgtccttgacgaagggctgctccag 736



to top

>emb|BX897699.1| Bartonella henselae strain Houston-1, complete genome
          Length = 1931047

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 395     cacgatcttctccctgatgttctc 418
               |||||||||||||||| |||||||
Sbjct: 1613909 cacgatcttctccctgttgttctc 1613932



to top

>gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, complete sequence
          Length = 189590

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   atacaaaattatacatggaa 123
             ||||||||||||||||||||
Sbjct: 20012 atacaaaattatacatggaa 20031



to top

>gb|AC093294.3| Homo sapiens chromosome 5 clone RP11-524C16, complete sequence
          Length = 171739

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 104    atacaaaattatacatggaa 123
              ||||||||||||||||||||
Sbjct: 138397 atacaaaattatacatggaa 138416



to top

>gb|AC060765.5|AC060765 Homo sapiens chromosome 8, clone RP11-653B10, complete sequence
          Length = 170392

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    tcatggacaatatattgatc 32
             ||||||||||||||||||||
Sbjct: 68532 tcatggacaatatattgatc 68551



to top

>gb|AF130084.1|AF130084 Homo sapiens clone FLB8310 PRO2225 mRNA, complete cds
          Length = 2296

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  tttcatggacaatatattga 30
           ||||||||||||||||||||
Sbjct: 211 tttcatggacaatatattga 230



to top

>gb|AC091500.1|AC091500 Drosophila melanogaster, chromosome 2R, region 54F-55A, BAC clone
              BACR20E20, complete sequence
          Length = 164567

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    agtacaactgagtacaaact 146
              ||||||||||||||||||||
Sbjct: 163386 agtacaactgagtacaaact 163367



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 73      ggtttggaaccaggaacgat 92
               ||||||||||||||||||||
Sbjct: 6355298 ggtttggaaccaggaacgat 6355279



to top

>gb|AF244565.1|AF244565 Takakia lepidozioides ribulose-bisphosphate carboxylase large
           subunit gene, partial cds; chloroplast gene for
           chloroplast product
          Length = 1200

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 14  catggacaatatattgatctctct 37
           ||||| ||||||||||||||||||
Sbjct: 274 catgggcaatatattgatctctct 251



to top

>dbj|AP001633.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0515G01
          Length = 175072

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 73     ggtttggaaccaggaacgat 92
              ||||||||||||||||||||
Sbjct: 126364 ggtttggaaccaggaacgat 126345



to top

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 328    tgtcatccttgatgaagggctgctccag 355
              |||| ||||||| |||||||||||||||
Sbjct: 821364 tgtcgtccttgacgaagggctgctccag 821391



to top

>emb|BX005447.8| Zebrafish DNA sequence from clone DKEY-29B14, complete sequence
          Length = 283185

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 140    acaaactagcaacagctatg 159
              ||||||||||||||||||||
Sbjct: 181005 acaaactagcaacagctatg 181024



to top

>emb|BX088551.7| Zebrafish DNA sequence from clone CH211-106A19 in linkage group 5,
             complete sequence
          Length = 184417

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   acaaactagcaacagctatg 159
             ||||||||||||||||||||
Sbjct: 69372 acaaactagcaacagctatg 69353



to top

>gb|AC153868.3| Mus musculus BAC RP23-384D16 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 211603

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 256    caaacctccgtaccttgatgttct 279
              ||||||||| ||||||||||||||
Sbjct: 188425 caaacctccctaccttgatgttct 188402



to top

>gb|AC153578.4| Mus musculus 6 BAC RP23-218P2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 228417

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 256    caaacctccgtaccttgatgttct 279
              ||||||||| ||||||||||||||
Sbjct: 109844 caaacctccctaccttgatgttct 109821



to top

>gb|U50042.1|DDU50042 Dictyostelium discoideum repE homolog of UV-damaged DNA binding
           protein (repE) gene, complete cds
          Length = 4122

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 96  aacaggtgatacaaaattatacat 119
           ||||| ||||||||||||||||||
Sbjct: 373 aacagttgatacaaaattatacat 350



to top

>gb|AE003801.4| Drosophila melanogaster chromosome 2R, section 49 of 73 of the complete
             sequence
          Length = 254899

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   agtacaactgagtacaaact 146
             ||||||||||||||||||||
Sbjct: 90643 agtacaactgagtacaaact 90624



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 328    tgtcatccttgatgaagggctgctccag 355
              |||| ||||||| |||||||||||||||
Sbjct: 492444 tgtcgtccttgacgaagggctgctccag 492471



to top

>gb|AC004640.1|AC004640 Drosophila melanogaster DNA sequence (P1s DS07528 (D169) and DS06665
             (D220)), complete sequence
          Length = 79248

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   agtacaactgagtacaaact 146
             ||||||||||||||||||||
Sbjct: 67887 agtacaactgagtacaaact 67868



to top

>gb|AC122284.5| Mus musculus BAC clone RP23-246A5 from 6, complete sequence
          Length = 189521

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 256    caaacctccgtaccttgatgttct 279
              ||||||||| ||||||||||||||
Sbjct: 160269 caaacctccctaccttgatgttct 160292



to top

>gb|AC142414.3| Mus musculus BAC clone RP23-372N15 from 8, complete sequence
          Length = 192261

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   gtgatacaaaattatacatg 120
             ||||||||||||||||||||
Sbjct: 66679 gtgatacaaaattatacatg 66698



to top

>emb|AL806516.4| Mouse DNA sequence from clone RP23-453N20 on chromosome X, complete
             sequence
          Length = 179534

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   caactgagtacaaactagca 150
             ||||||||||||||||||||
Sbjct: 79655 caactgagtacaaactagca 79674



to top

>dbj|AB238686.1| Thiobacillus thioparus scnC, orf1, orf2, orf3, orf4, orf5 genes for
            thiocyanate hydrolase gamma subunit, thiocyanate
            hydrolase activator, putative ABC transporter subunit,
            putative ABC transporter subunit, putative ABC
            transporter subunit, putative ABC transporter subunit,
            partial and complete cds
          Length = 4910

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 307  cgagatccttcaccgtcttg 326
            ||||||||||||||||||||
Sbjct: 2491 cgagatccttcaccgtcttg 2472



to top

>emb|AL132656.15|HSA119F19 Human DNA sequence from clone RP11-119F19 on chromosome 10, complete
              sequence
          Length = 153370

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     tttcatggacaatatattga 30
              ||||||||||||||||||||
Sbjct: 101245 tttcatggacaatatattga 101226


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,250,287
Number of Sequences: 3902068
Number of extensions: 3250287
Number of successful extensions: 62607
Number of sequences better than 10.0: 54
Number of HSP's better than 10.0 without gapping: 54
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62337
Number of HSP's gapped (non-prelim): 263
length of query: 426
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 404
effective length of database: 17,147,199,772
effective search space: 6927468707888
effective search space used: 6927468707888
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top