>gb|BT008920.1| Triticum aestivum clone wyr1c.pk001.j6:fis, full insert mRNA
           sequence
          Length = 955

 Score =  190 bits (96), Expect = 3e-45
 Identities = 146/164 (89%), Gaps = 9/164 (5%)
 Strand = Plus / Minus

                                                                       
Query: 297 ttctgtaggggtccaatctcgagggggcaagtgggcaatctgggcagccagccatgtcat 356
           |||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||
Sbjct: 694 ttctgtaggggtccaatctcaagggggcaagtgggcaatttgggcagcgagccatgtcat 635

                                                                       
Query: 357 gtagttccggtagtaccgtccgtggatgttgtagttgcaatcctagtcttttcaggcaat 416
           |||||||| ||| | | ||| |||||||||||||||||||||||         |||||||
Sbjct: 634 gtagttccagtaatgcagtcagtggatgttgtagttgcaatcct---------aggcaat 584

                                                       
Query: 417 cagtgtgatgaagcggcatgttgcttgtgtcaccctgtttcttt 460
            |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 583 tagtgtgatgaagcggcatgttgcttgtgtcaccctgtttcttt 540



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 110/131 (83%), Gaps = 11/131 (8%)
 Strand = Plus / Minus

                                                                       
Query: 140 aagccacattaggcactccttgccgcactaggacaaaatgcgggatgtg--------aac 191
           |||||||| |||||||||||||  ||||||| ||||||||| |||||||        |||
Sbjct: 854 aagccacagtaggcactccttgttgcactag-acaaaatgcaggatgtgcctatgggaac 796

                                                                       
Query: 192 acacccaaaatcgttgtgcatgctaaagcggcaacataagccaggtgagatttcacatct 251
           |||||||| || ||||  ||||| ||||||||||||||| |||||||||||||| |||||
Sbjct: 795 acacccaacatagttg--catgccaaagcggcaacataaaccaggtgagatttcgcatct 738

                      
Query: 252 actccgtttgg 262
           ||||| |||||
Sbjct: 737 actccatttgg 727

>gb|AC150774.2| Xenopus tropicalis clone CH216-82E5, complete sequence
          Length = 87104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 50    tttgacaaaatggaacaactg 70
             |||||||||||||||||||||
Sbjct: 14614 tttgacaaaatggaacaactg 14634

>ref|XM_968049.1| PREDICTED: Tribolium castaneum similar to CG8520-PA (LOC661919), mRNA
          Length = 1317

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 413  caatcagtgtgatgaagcggc 433
            |||||||||||||||||||||
Sbjct: 1057 caatcagtgtgatgaagcggc 1037

>dbj|AP006127.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT48O21, TM0211,
              complete sequence
          Length = 137303

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 176    aatgcgggatgtgaacacacc 196
              |||||||||||||||||||||
Sbjct: 109744 aatgcgggatgtgaacacacc 109764

>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome
          Length = 3481691

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 327     gtgggcaatctgggcagcca 346
               ||||||||||||||||||||
Sbjct: 1903831 gtgggcaatctgggcagcca 1903812

>ref|XM_414496.1| PREDICTED: Gallus gallus similar to Methionine adenosyltransferase
           II, beta (LOC416164), mRNA
          Length = 771

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 54  acaaaatggaacaactgata 73
           ||||||||||||||||||||
Sbjct: 642 acaaaatggaacaactgata 661

>gb|AY339245.1| Malacocottus zonurus isolate Malzon ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339243.1| Myoxocephalus sp. M_sp207 ATPase 8 gene, complete cds; and ATPase 6
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 839

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339241.1| Myoxocephalus octodecemspinosus isolate Moct2179 ATPase 8 gene,
           complete cds; and ATPase 6 gene, partial cds;
           mitochondrial genes for mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339240.1| Myoxocephalus aenaeus isolate Maen2128 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339239.1| Myoxocephalus aenaeus isolate Maen2126 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339235.1| Triglopsis quadricornis haplotype Arc2 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 832

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339234.1| Triglopsis quadricornis haplotype Arc1 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 837

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339233.1| Triglopsis quadricornis haplotype Eur5 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 837

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339232.1| Triglopsis quadricornis haplotype Eur4 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339231.1| Triglopsis quadricornis haplotype Eur3 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 839

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY339230.1| Triglopsis quadricornis haplotype Eur1 ATPase 8 gene, complete cds;
           and ATPase 6 gene, partial cds; mitochondrial genes for
           mitochondrial products
          Length = 832

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I13 on chromosome Xq23-25 Contains
              an alpha tubulin pseudogene, complete sequence
          Length = 122400

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 56     aaaatggaacaactgatatgcaca 79
              ||||||||||||||||| ||||||
Sbjct: 113972 aaaatggaacaactgatttgcaca 113995

>gb|AC021224.7|AC021224 Homo sapiens chromosome 18, clone RP11-158N19, complete sequence
          Length = 151794

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   agccaggtgagatttcacat 249
             ||||||||||||||||||||
Sbjct: 59283 agccaggtgagatttcacat 59302

>gb|AY833325.1| Scorpaenichthys marmoratus ATPase 8 (ATP8) gene, complete cds; and
           ATPase 6 (ATP6) gene, partial cds; mitochondrial
          Length = 841

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY116339.1| Triglopsis quadricornis ATPase 8 gene, complete cds; and ATPase 6
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 837

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AY116308.1| Malacocottus zonurus ATPase 8 gene, complete cds; and ATPase 6
           gene, partial cds; mitochondrial genes for mitochondrial
           products
          Length = 841

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 391 ttgcaatcctagtcttttca 410
           ||||||||||||||||||||
Sbjct: 29  ttgcaatcctagtcttttca 48

>gb|AE001439.1| Helicobacter pylori J99, complete genome
          Length = 1643831

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 197    caaaatcgttgtgcatgctaaagc 220
              ||||||| ||||||||||||||||
Sbjct: 992030 caaaatctttgtgcatgctaaagc 992053

>gb|AC092479.16| Mus musculus strain C57BL/6J chromosome 3 clone rp23-231l15, complete
             sequence
          Length = 142159

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    atttgacaaaatggaacaac 68
             ||||||||||||||||||||
Sbjct: 61986 atttgacaaaatggaacaac 61967

>gb|AC093317.22| Mus musculus strain C57BL/6J chromosome 3 clone rp23-218k6, complete
              sequence
          Length = 214004

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 49     atttgacaaaatggaacaac 68
              ||||||||||||||||||||
Sbjct: 201231 atttgacaaaatggaacaac 201212

>dbj|AP004449.1| Enedrias crassispina mitochondrial DNA, complete genome
          Length = 16522

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 391  ttgcaatcctagtcttttca 410
            ||||||||||||||||||||
Sbjct: 7985 ttgcaatcctagtcttttca 8004


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,568,503
Number of Sequences: 3902068
Number of extensions: 3568503
Number of successful extensions: 73177
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73130
Number of HSP's gapped (non-prelim): 47
length of query: 460
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 438
effective length of database: 17,147,199,772
effective search space: 7510473500136
effective search space used: 7510473500136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)