Clone Name | rbastl41a05 |
---|---|
Clone Library Name | barley_pub |
>emb|CR391935.9| Zebrafish DNA sequence from clone DKEY-256K13 in linkage group 23, complete sequence Length = 197191 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 411 aacactgatgatcagatttca 431 ||||||||||||||||||||| Sbjct: 129588 aacactgatgatcagatttca 129568
>emb|BX469903.9| Zebrafish DNA sequence from clone CH211-46H12 in linkage group 23, complete sequence Length = 175747 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 411 aacactgatgatcagatttca 431 ||||||||||||||||||||| Sbjct: 165732 aacactgatgatcagatttca 165712
>dbj|AP003387.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-700F9, complete sequence Length = 185017 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 275 tgctgaaattctctattccat 295 ||||||||||||||||||||| Sbjct: 154777 tgctgaaattctctattccat 154757
>dbj|AP003027.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-25I9, complete sequence Length = 167067 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 275 tgctgaaattctctattccat 295 ||||||||||||||||||||| Sbjct: 43748 tgctgaaattctctattccat 43728
>gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, complete sequence Length = 194854 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 121 ctgcattcatacacacaaac 140 |||||||||||||||||||| Sbjct: 103240 ctgcattcatacacacaaac 103259
>gb|AC146377.5| Pan troglodytes BAC clone RP43-79B6 from 7, complete sequence Length = 195459 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 273 tctgctgaaattctctattc 292 |||||||||||||||||||| Sbjct: 96697 tctgctgaaattctctattc 96678
>gb|AF133242.2| SVTS2 plectrovirus, complete genome Length = 6825 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 263 agtaatttcatctgctgaaa 282 |||||||||||||||||||| Sbjct: 4621 agtaatttcatctgctgaaa 4602
>gb|AC002067.2| Homo sapiens BAC clone CTB-126M9 from 7, complete sequence Length = 162912 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 273 tctgctgaaattctctattc 292 |||||||||||||||||||| Sbjct: 70144 tctgctgaaattctctattc 70125
>gb|AC159716.6| Mus musculus 6 BAC RP23-80P15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 239739 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 agatttcatgaccaaggcag 443 |||||||||||||||||||| Sbjct: 145293 agatttcatgaccaaggcag 145312
>gb|AC117399.2| Homo sapiens 3 BAC RP11-179B14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 94000 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 atgaccaaatggaaacacac 83 |||||||||||||||||||| Sbjct: 87083 atgaccaaatggaaacacac 87102
>gb|AC091914.3| Homo sapiens chromosome 5 clone RP11-221N1, complete sequence Length = 165237 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 tcatgaccaaatggaaacac 81 |||||||||||||||||||| Sbjct: 133658 tcatgaccaaatggaaacac 133639
>gb|AC025445.5| Homo sapiens chromosome 5 clone CTD-2049O17, complete sequence Length = 184635 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 368 catgttccagaaacaccaac 387 |||||||||||||||||||| Sbjct: 58844 catgttccagaaacaccaac 58863
>gb|AC084213.19|AC084213 Mus musculus 1 BAC RP23-470F8 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 109501 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 423 cagatttcatgaccaaggca 442 |||||||||||||||||||| Sbjct: 32914 cagatttcatgaccaaggca 32933
>gb|AC007746.4| Homo sapiens BAC clone RP11-520M23 from 2, complete sequence Length = 45296 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 262 cagtaatttcatctgctgaa 281 |||||||||||||||||||| Sbjct: 40501 cagtaatttcatctgctgaa 40520
>gb|AC108514.3| Homo sapiens BAC clone RP11-234L7 from 2, complete sequence Length = 97944 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 412 acactgatgatcagatttca 431 |||||||||||||||||||| Sbjct: 61147 acactgatgatcagatttca 61166
>gb|AC138111.3| Mus musculus BAC clone RP24-262B6 from 1, complete sequence Length = 138380 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 423 cagatttcatgaccaaggca 442 |||||||||||||||||||| Sbjct: 121939 cagatttcatgaccaaggca 121920
>gb|AC152962.1| Mus musculus 6 BAC RP23-465F11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 187047 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 424 agatttcatgaccaaggcag 443 |||||||||||||||||||| Sbjct: 30241 agatttcatgaccaaggcag 30260 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,653,797 Number of Sequences: 3902068 Number of extensions: 3653797 Number of successful extensions: 72734 Number of sequences better than 10.0: 17 Number of HSP's better than 10.0 without gapping: 17 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 72708 Number of HSP's gapped (non-prelim): 26 length of query: 443 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 421 effective length of database: 17,147,199,772 effective search space: 7218971104012 effective search space used: 7218971104012 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)