ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl40h08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC009027.10| Homo sapiens chromosome 16 clone RP11-123C5, com... 46 0.050
2gb|AC009131.6|AC009131 Homo sapiens chromosome 16 clone RP11-502... 46 0.050
3gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, com... 40 3.1
4gb|AC159968.3| Mus musculus chromosome 3, clone RP23-256J12, com... 40 3.1
5dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 3.1
6gb|AC063953.13| Homo sapiens 3 BAC RP11-317I15 (Roswell Park Can... 40 3.1
7gb|AC005693.3| Arabidopsis thaliana chromosome 2 clone T25N22 ma... 40 3.1
8gb|AC013264.4| Homo sapiens BAC clone RP11-184N4 from 2, complet... 40 3.1

>gb|AC009027.10| Homo sapiens chromosome 16 clone RP11-123C5, complete sequence
          Length = 178256

 Score = 46.1 bits (23), Expect = 0.050
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 101   cccagcaaccaaatgtggtttcgacac 127
             ||||||||||||||||| |||||||||
Sbjct: 13768 cccagcaaccaaatgtgttttcgacac 13794



to top

>gb|AC009131.6|AC009131 Homo sapiens chromosome 16 clone RP11-502K10, complete sequence
          Length = 180835

 Score = 46.1 bits (23), Expect = 0.050
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 101   cccagcaaccaaatgtggtttcgacac 127
             ||||||||||||||||| |||||||||
Sbjct: 98308 cccagcaaccaaatgtgttttcgacac 98334



to top

>gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, complete sequence
          Length = 171020

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     tattctgtagatagatagat 38
              ||||||||||||||||||||
Sbjct: 138337 tattctgtagatagatagat 138356



to top

>gb|AC159968.3| Mus musculus chromosome 3, clone RP23-256J12, complete sequence
          Length = 153684

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    tattctgtagatagatagat 38
             ||||||||||||||||||||
Sbjct: 78720 tattctgtagatagatagat 78739



to top

>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence
          Length = 1877212

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 142     tatcgcagcagcagataagc 161
               ||||||||||||||||||||
Sbjct: 1191289 tatcgcagcagcagataagc 1191270



to top

>gb|AC063953.13| Homo sapiens 3 BAC RP11-317I15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 185259

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 214    catgggaaagggagagcaca 233
              ||||||||||||||||||||
Sbjct: 143517 catgggaaagggagagcaca 143498



to top

>gb|AC005693.3| Arabidopsis thaliana chromosome 2 clone T25N22 map mi310, complete
             sequence
          Length = 80891

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    tactcttacacattagaaat 66
             ||||||||||||||||||||
Sbjct: 13207 tactcttacacattagaaat 13226



to top

>gb|AC013264.4| Homo sapiens BAC clone RP11-184N4 from 2, complete sequence
          Length = 149445

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 48     actcttacacattagaaatacaaa 71
              ||||||| ||||||||||||||||
Sbjct: 118148 actcttaaacattagaaatacaaa 118125


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,361,070
Number of Sequences: 3902068
Number of extensions: 3361070
Number of successful extensions: 81645
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81623
Number of HSP's gapped (non-prelim): 22
length of query: 242
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 220
effective length of database: 17,147,199,772
effective search space: 3772383949840
effective search space used: 3772383949840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top