>gb|AC004896.1| Homo sapiens PAC clone RP4-811H12 from 7, complete sequence
          Length = 162215

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 235   cacgcattcagctatttcag 254
             ||||||||||||||||||||
Sbjct: 49678 cacgcattcagctatttcag 49659

>gb|AC132255.3| Mus musculus BAC clone RP24-472I15 from chromosome 5, complete sequence
          Length = 168528

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   caataccagtactagttact 151
             ||||||||||||||||||||
Sbjct: 33617 caataccagtactagttact 33636

>emb|Z95326.1|HS344F17 Human DNA sequence from clone RP3-344F17 on chromosome 6q22.1-22.33
             Contains part of the gene for a novel protein similar to
             FLJ13018 and other hypothetical proteins, complete
             sequence
          Length = 85832

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    tcacaaaagcaccaggaata 67
             ||||||||||||||||||||
Sbjct: 25072 tcacaaaagcaccaggaata 25091

>emb|AL157702.10| Human DNA sequence from clone RP11-18B16 on chromosome 9 Contains the
             3' end of a novel gene and a novel pseudogene, complete
             sequence
          Length = 160990

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 185   tattacataccagtgttcta 204
             ||||||||||||||||||||
Sbjct: 18880 tattacataccagtgttcta 18899

>emb|Z99110.2|BSUB0007 Bacillus subtilis complete genome (section 7 of 21): from 1209742 to
              1410982
          Length = 201241

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 240    attcagctatttcagcgaag 259
              ||||||||||||||||||||
Sbjct: 186084 attcagctatttcagcgaag 186065

>emb|AJ002571.1|BSAJ2571 Bacillus subtilis 168 56 kb DNA fragment between xlyA and ykoR
          Length = 55593

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 240   attcagctatttcagcgaag 259
             ||||||||||||||||||||
Sbjct: 48644 attcagctatttcagcgaag 48625

>gb|AC091078.7| Homo sapiens, clone RP11-164C12, complete sequence
          Length = 182776

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 77     gtccaactcaaacttcagcc 96
              ||||||||||||||||||||
Sbjct: 120178 gtccaactcaaacttcagcc 120197

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 280    tctgctcgtgggtggcgccc 299
              ||||||||||||||||||||
Sbjct: 450258 tctgctcgtgggtggcgccc 450239

>gb|AC012003.9| Homo sapiens BAC clone RP11-498P13 from 2, complete sequence
          Length = 195950

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 187    ttacataccagtgttctagg 206
              ||||||||||||||||||||
Sbjct: 155703 ttacataccagtgttctagg 155722

>gb|U73166.1|U73166 Homo sapiens cosmid clone LUCA15 from 3p21.3, complete sequence
          Length = 8829

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 315  gctgcgggtgggggcagcgg 334
            ||||||||||||||||||||
Sbjct: 8527 gctgcgggtgggggcagcgg 8508


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,074,951
Number of Sequences: 3902068
Number of extensions: 2074951
Number of successful extensions: 37547
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37507
Number of HSP's gapped (non-prelim): 40
length of query: 346
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 324
effective length of database: 17,147,199,772
effective search space: 5555692726128
effective search space used: 5555692726128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)