ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl40g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY483152.1| Hordeum vulgare putative cellulose synthase catal... 694 0.0
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
3dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
4dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
5dbj|AK121193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
6dbj|AK073561.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
7dbj|AK071976.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
8dbj|AK067386.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
9dbj|AK062154.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
10gb|AC171105.1| Drosophila melanogaster clone CH223-40I08, comple... 50 0.005
11emb|AL031024.1|DMC196F3 Drosophila melanogaster cosmid clone 196F3 50 0.005
12emb|BX927082.9| Zebrafish DNA sequence from clone DKEY-182O15 in... 50 0.005
13ref|NM_130570.2| Drosophila melanogaster CG32810-RB (CG32810), mRNA 50 0.005
14gb|AY070888.1| Drosophila melanogaster LD45918 full length cDNA 50 0.005
15gb|AY069257.1| Drosophila melanogaster GM03763 full length cDNA 50 0.005
16gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 50 0.005
17gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, c... 48 0.021
18gb|AC158939.9| Mus musculus chromosome 5, clone RP23-204A8, comp... 48 0.021
19gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, co... 48 0.021
20gb|AC124436.5| Mus musculus BAC clone RP24-252O24 from chromosom... 48 0.021
21emb|BX470191.8| Zebrafish DNA sequence from clone CH211-89N7 in ... 48 0.021
22gb|AE014176.1| Mus musculus piebald deletion region section 4 of... 48 0.021
23gb|AC104828.4| Homo sapiens BAC clone RP11-804N11 from 4, comple... 48 0.021
24gb|AC091635.1|AC091635 Drosophila melanogaster, chromosome 2R, r... 48 0.021
25gb|AC008347.2|AC008347 Drosophila melanogaster, chromosome 2R, r... 48 0.021
26gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome ... 48 0.021
27emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in... 48 0.021
28gb|AC145419.3| Dasypus novemcinctus clone VMRC5-468K1, complete ... 48 0.021
29gb|AC154420.2| Mus musculus BAC clone RP24-212L9 from 14, comple... 48 0.021
30gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58... 48 0.021
31gb|AC004250.1|AC004250 Drosophila melanogaster (P1 DS05897 (D171... 48 0.021
32gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, compl... 48 0.021
33gb|AC156987.7| Mus musculus chromosome 7, clone RP23-78K13, comp... 46 0.084
34gb|AC122230.4| Mus musculus BAC clone RP23-133F23 from 9, comple... 46 0.084
35gb|AC161114.4| Mus musculus BAC clone RP24-338A5 from chromosome... 46 0.084
36emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 46 0.084
37emb|AL731613.5|OSJN00257 Oryza sativa genomic DNA, chromosome 4,... 46 0.084
38dbj|AK078692.1| Mus musculus adult male eyeball cDNA, RIKEN full... 46 0.084
39dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.084
40gb|AC157213.2| Mus musculus BAC clone RP23-157N5 from chromosome... 46 0.084
41gb|AC139378.4| Mus musculus BAC clone RP23-265F20 from 9, comple... 46 0.084
42gb|AC132407.3| Mus musculus BAC clone RP23-343G12 from 8, comple... 46 0.084
43emb|AL831746.5| Mouse DNA sequence from clone RP23-67O11 on chro... 46 0.084
44emb|AL035331.1|DMC33C11 Drosophila melanogaster cosmid clone 33C11 46 0.084
45gb|AC114993.18| Mus musculus chromosome 5, clone RP23-42D10, com... 44 0.33
46gb|AC163351.2| Mus musculus BAC clone RP23-150D4 from chromosome... 44 0.33
47gb|AC139293.4| Mus musculus BAC clone RP24-381N4 from chromosome... 44 0.33
48gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, comp... 44 0.33
49ref|NM_001030622.1| Gallus gallus kinesin family member 3A (KIF3... 44 0.33
50gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosom... 44 0.33
51ref|XM_414646.1| PREDICTED: Gallus gallus similar to Kinesin-lik... 44 0.33
52gb|AC123731.9| Mus musculus chromosome 15, clone RP23-458N23, co... 44 0.33
53gb|AC158789.4| Mus musculus chromosome 5, clone RP23-192C21, com... 44 0.33
54gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.33
55gb|AC163668.5| Mus musculus BAC clone RP23-32P22 from chromosome... 44 0.33
56gb|AC155728.13| Mus musculus 6 BAC RP24-162H1 (Roswell Park Canc... 44 0.33
57gb|AC122402.2| Mus musculus BAC clone RP24-108B4 from chromosome... 44 0.33
58gb|AC119395.2| Mus musculus chromosome 8 clone MGS1-178N23 map A... 44 0.33
59gb|AC112151.3| Mus musculus BAC clone RP24-86M8 from 2, complete... 44 0.33
60gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, co... 44 0.33
61gb|U40427.1| Caenorhabditis elegans cosmid F43C9, complete sequence 44 0.33
62gb|AC161413.5| Mus musculus chromosome 19, clone RP23-106D17, co... 44 0.33
63gb|AC146154.3| Pan troglodytes BAC clone RP43-37E8 from 7, compl... 44 0.33
64emb|AL162274.17| Human DNA sequence from clone RP11-45A17 on chr... 44 0.33
65emb|AL160058.8| Human DNA sequence from clone RP11-280O1 on chro... 44 0.33
66emb|AL049634.8|HSJ576H24 Human DNA sequence from clone RP4-576H2... 44 0.33
67gb|AC127142.3| Rattus norvegicus 4 BAC CH230-41K13 (Children's H... 44 0.33
68emb|AL591174.13| Mouse DNA sequence from clone RP23-271B20 on ch... 44 0.33
69emb|AJ851728.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.33
70emb|BX005100.9| Mouse DNA sequence from clone RP23-76P22 on chro... 44 0.33
71emb|AJ621737.1| Gallus gallus partial KIF3A gene for kinesin-lik... 44 0.33
72emb|CR354750.1| Mus musculus chromosome 6, clone tr151 strain 12... 44 0.33
73gb|AC107624.1| Homo sapiens chromosome 3 clone RP11-744H21, comp... 44 0.33
74gb|AC099779.2| Homo sapiens chromosome 3 clone RP11-760G13, comp... 44 0.33
75gb|DQ099567.1| Taenia pisiformis isolate KAP701 5.8S ribosomal R... 44 0.33
76dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
77dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
78dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
79gb|AC122764.12| Mus musculus chromosome 15, clone RP24-93B16, co... 44 0.33
80gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, r... 44 0.33
81gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, ... 44 0.33
82dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
83dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
84gb|AC079183.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 44 0.33
85dbj|AP005463.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
86dbj|AP004329.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.33
87gb|AC124129.13| Mus musculus chromosome 5, clone RP23-198B3, com... 44 0.33
88emb|AL928733.14| Mouse DNA sequence from clone RP23-190O13 on ch... 44 0.33
89gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88... 44 0.33
90gb|AC171917.14| Mus musculus chromosome 8, clone RP23-390K13, co... 44 0.33
91gb|AC171678.8| Mus musculus chromosome 8, clone RP24-104E12, com... 44 0.33
92gb|AC134435.3| Mus musculus BAC clone RP24-423J19 from 1, comple... 44 0.33
93gb|AC159985.2| Gallus gallus BAC clone CH261-18F10 from chromoso... 44 0.33
94gb|AC131685.4| Mus musculus BAC clone RP23-372G24 from 1, comple... 44 0.33
95emb|AL669855.20| Mouse DNA sequence from clone RP23-82I5 on chro... 44 0.33
96emb|AL671964.7| Mouse DNA sequence from clone RP23-198N23 on chr... 44 0.33
97gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, co... 42 1.3
98gb|AC163689.3| Mus musculus BAC clone CH36-200G6 from chromosome... 42 1.3
99gb|AC167720.2| Mus musculus BAC clone RP24-216G15 from chromosom... 42 1.3
100ref|XM_470347.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.3
101gb|AF110520.1|MMHC425O18 Mus musculus major histocompatibility c... 42 1.3
102gb|AF380987.1| Musca domestica microsatellite MdCA224 sequence 42 1.3
103gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosom... 42 1.3
104gb|AC131919.13| Mus musculus chromosome 15, clone RP24-239J20, c... 42 1.3
105gb|AC135079.9| Mus musculus chromosome 15, clone RP24-439P7, com... 42 1.3
106gb|AC147992.3| Mus musculus BAC clone RP24-384K8 from chromosome... 42 1.3
107gb|AC107764.11| Mus musculus chromosome 15, clone RP23-179A6, co... 42 1.3
108gb|AC125446.12| Mus musculus chromosome 14, clone RP24-501J23, c... 42 1.3
109gb|AC124998.10| Mus musculus chromosome 10, clone RP24-350B12, c... 42 1.3
110gb|BC004079.1| Mus musculus mercaptopyruvate sulfurtransferase, ... 42 1.3
111gb|AC110883.12| Mus musculus chromosome 8, clone RP23-200N24, co... 42 1.3
112gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.3
113gb|AC126029.3| Mus musculus BAC clone RP23-389K5 from chromosome... 42 1.3
114gb|AC124432.5| Mus musculus BAC clone RP24-243L15 from chromosom... 42 1.3
115gb|AC132268.3| Mus musculus BAC clone RP24-399H6 from chromosome... 42 1.3
116gb|AC125044.3| Mus musculus BAC clone RP23-348B10 from chromosom... 42 1.3
117gb|AC121838.2| Mus musculus BAC clone RP24-74O18 from 1, complet... 42 1.3
118gb|AC114569.7| Mus musculus chromosome 6, clone RP23-139J6, comp... 42 1.3
119emb|Z81311.1|HSU244G10 Human DNA sequence from clone LL0XNC01-24... 42 1.3
120emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on ch... 42 1.3
121emb|AL033519.42|HS340B19 Human DNA sequence from clone RP3-340B1... 42 1.3
122emb|AL669822.10| Mouse DNA sequence from clone RP23-47J12 on chr... 42 1.3
123emb|AL591496.13| Mouse DNA sequence from clone RP23-384C18 on ch... 42 1.3
124gb|AC154233.3| Mus musculus BAC clone RP24-345G9 from chromosome... 42 1.3
125emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on ch... 42 1.3
126emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on ch... 42 1.3
127gb|AC171138.2| Helobdella robusta clone CH306-1A9, complete sequ... 42 1.3
128emb|BX004828.21| Zebrafish DNA sequence from clone DKEY-185M8, c... 42 1.3
129gb|AC100868.2| Homo sapiens chromosome 8, clone RP11-246K8, comp... 42 1.3
130dbj|AK136571.1| Mus musculus adult male cecum cDNA, RIKEN full-l... 42 1.3
131emb|AL672153.3| Mouse DNA sequence from clone RP23-8C14 on chrom... 42 1.3
132emb|BX890623.6| Mouse DNA sequence from clone RP23-83O23 on chro... 42 1.3
133dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.3
134gb|AC008331.7|AC008331 Drosophila melanogaster, chromosome 2L, r... 42 1.3
135gb|BC094469.1| Mus musculus mercaptopyruvate sulfurtransferase, ... 42 1.3
136gb|AC007330.6|AC007330 Drosophila melanogaster, chromosome 2R, r... 42 1.3
137gb|AC007413.5|AC007413 Drosophila melanogaster, chromosome 2R, r... 42 1.3
138emb|BX679659.7| Mouse DNA sequence from clone RP23-125B17 on chr... 42 1.3
139gb|AC106876.3| Homo sapiens BAC clone RP11-512N9 from 2, complet... 42 1.3
140gb|AC104487.3| Oryza sativa chromosome 3 BAC OSJNBa0042I09 genom... 42 1.3
141gb|AC008939.8| Homo sapiens chromosome 5 clone CTD-2316B1, compl... 42 1.3
142gb|AC090907.14| Homo sapiens chromosome 15, clone RP11-505E24, c... 42 1.3
143emb|AL928824.13| Zebrafish DNA sequence from clone CH211-105D18 ... 42 1.3
144dbj|AK100877.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.3
145dbj|AK101178.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.3
146emb|CT573036.11| Mouse DNA sequence from clone RP24-376I11 on ch... 42 1.3
147dbj|AK060814.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.3
148gb|AC105165.11| Mus musculus chromosome 18, clone RP24-302C24, c... 42 1.3
149emb|CT030732.13| Mouse DNA sequence from clone RP23-27D5 on chro... 42 1.3
150gb|AE003622.4| Drosophila melanogaster chromosome 2L, section 31... 42 1.3
151gb|AE003831.3| Drosophila melanogaster chromosome 2R, section 19... 42 1.3
152emb|AL928856.5| Mouse DNA sequence from clone RP23-413G24 on chr... 42 1.3
153gb|AC110519.13| Mus musculus chromosome 8, clone RP23-183M15, co... 42 1.3
154emb|AL840625.9| Mouse DNA sequence from clone RP23-343F17 on chr... 42 1.3
155emb|AL590144.10| Mouse DNA sequence from clone RP23-79F10 on chr... 42 1.3
156gb|AC124471.4| Mus musculus BAC clone RP24-79D7 from 12, complet... 42 1.3
157gb|AC142262.3| Mus musculus BAC clone RP24-486I4 from 8, complet... 42 1.3
158gb|BC006066.1| Mus musculus mercaptopyruvate sulfurtransferase, ... 42 1.3
159ref|NM_138670.2| Mus musculus mercaptopyruvate sulfurtransferase... 42 1.3
160emb|AJ418551.1|SAU418551 Sparus aurata satellite DNA, clone SAge... 42 1.3
161emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chr... 42 1.3
162emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chr... 42 1.3
163emb|AL845165.4| Mouse DNA sequence from clone RP23-281N9 on chro... 42 1.3
164gb|AC115795.11| Mus musculus chromosome 5, clone RP23-400O10, co... 40 5.2
165gb|AC115905.8| Mus musculus chromosome 1, clone RP24-472N17, com... 40 5.2
166gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, com... 40 5.2
167gb|AC126539.9| Mus musculus chromosome 8, clone RP24-112G5, comp... 40 5.2
168gb|AC166253.18| Mus musculus BAC RP23-231M6 (Roswell Park Cance... 40 5.2
169gb|AC147806.5| Mus musculus chromosome 1, clone RP23-6O16, compl... 40 5.2
170gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, co... 40 5.2
171gb|AC152953.1| Mus musculus 10 BAC RP23-403E19 (Roswell Park Can... 40 5.2
172gb|AC124821.5| Mus musculus chromosome 1, clone RP24-211L16, com... 40 5.2
173gb|AC163280.2| Mus musculus BAC clone RP23-478G5 from chromosome... 40 5.2
174gb|AC166491.8| Mus musculus chromosome 15, clone RP24-380A15, co... 40 5.2
175gb|AC122313.4| Mus musculus BAC clone RP23-300N8 from chromosome... 40 5.2
176gb|AC105173.10| Mus musculus chromosome 8, clone RP23-319J15, co... 40 5.2
177gb|AC116792.17| Mus musculus chromosome 6, clone RP24-304O23, co... 40 5.2
178gb|AC167012.3| Mus musculus BAC clone RP23-416A5 from chromosome... 40 5.2
179gb|AC123609.11| Mus musculus chromosome 3, clone RP23-281B17, co... 40 5.2
180gb|AC152753.1| Mus musculus chromosome 17 clone RP23-65L9, compl... 40 5.2
181gb|AC120878.10| Mus musculus chromosome 1, clone RP24-548K2, com... 40 5.2
182gb|AC160118.2| Mus musculus BAC clone RP23-440L7 from chromosome... 40 5.2
183gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome ... 40 5.2
184gb|AC165356.5| Mus musculus BAC clone RP23-142E18 from chromosom... 40 5.2
185gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome... 40 5.2
186gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome... 40 5.2
187gb|AC154204.2| Mus musculus BAC clone RP24-393D5 from chromosome... 40 5.2
188gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome... 40 5.2
189gb|AC166332.7| Mus musculus chromosome 1, clone RP24-266F18, com... 40 5.2
190gb|AC158976.14| Mus musculus chromosome 15, clone RP24-71M3, com... 40 5.2
191gb|AC163447.5| Mus musculus chromosome 7, clone RP24-314E16, com... 40 5.2
192gb|AC120865.7| Mus musculus chromosome 5, clone RP23-88L6, compl... 40 5.2
193gb|AC120871.12| Mus musculus chromosome 16, clone RP23-121E8, co... 40 5.2
194gb|AC102611.10| Mus musculus chromosome 1, clone RP23-416O18, co... 40 5.2
195gb|AC104918.13| Mus musculus chromosome 7, clone RP23-335G1, com... 40 5.2
196gb|AC113325.7| Mus musculus chromosome 1, clone RP23-453H23, com... 40 5.2
197gb|AC109205.12| Mus musculus chromosome 7, clone RP23-137A4, com... 40 5.2
198ref|NM_177075.2| Mus musculus RIKEN cDNA C030019I05 gene (C03001... 40 5.2
199gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, co... 40 5.2
200gb|AC109184.7| Mus musculus chromosome 8, clone RP24-386O11, com... 40 5.2
201gb|AC137121.9| Mus musculus chromosome 5, clone RP23-286M22, com... 40 5.2
202gb|AC115855.9| Mus musculus chromosome 3, clone RP24-277E17, com... 40 5.2
203gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, c... 40 5.2
204gb|AC169697.1| Rhesus Macaque BAC CH250-38L23 (Children's Hospi... 40 5.2
205gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, compl... 40 5.2
206gb|CP000081.1| Leishmania major chromosome 35, complete sequence 40 5.2
207gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases ... 40 5.2
208gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 40 5.2
209gb|AC159441.1| Trypanosoma brucei chromosome 5 clone RPCI93-30F7... 40 5.2
210gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8... 40 5.2
211gb|AC102517.7| Mus musculus chromosome 5, clone RP24-491H24, com... 40 5.2
212gb|AC102380.6| Mus musculus chromosome 3, clone RP24-179F24, com... 40 5.2
213gb|AC168268.2| Mus musculus BAC clone RP23-339K12 from chromosom... 40 5.2
214gb|AC167421.2| Mus musculus BAC clone RP23-143K19 from chromosom... 40 5.2
215gb|AC119266.14| Mus musculus chromosome 13, clone RP24-321G8, co... 40 5.2
216gb|AC116525.24| Mus musculus chromosome 15, clone RP24-352I18, c... 40 5.2
217gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, com... 40 5.2
218gb|AC165091.3| Mus musculus BAC clone RP23-25M19 from chromosome... 40 5.2
219gb|AC151843.3| Mus musculus BAC clone RP23-88K14 from chromosome... 40 5.2
220gb|AC154523.2| Mus musculus BAC clone RP24-65H12 from chromosome... 40 5.2
221gb|AC164646.3| Mus musculus BAC clone RP24-262I1 from chromosome... 40 5.2
222gb|AC151715.3| Mus musculus BAC clone RP23-396L12 from chromosom... 40 5.2
223gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome... 40 5.2
224gb|AC110036.8| Mus musculus chromosome 7, clone RP23-254F9, comp... 40 5.2
225gb|AC109186.7| Mus musculus chromosome 5, clone RP24-351E22, com... 40 5.2
226gb|AC120366.9| Mus musculus chromosome 1, clone RP24-294P1, comp... 40 5.2
227gb|AC139225.10| Mus musculus chromosome 9, clone RP24-361G12, co... 40 5.2
228gb|AC131980.9| Mus musculus chromosome 1, clone RP24-170O7, comp... 40 5.2
229gb|AC119908.16| Mus musculus chromosome 7, clone RP24-240G4, com... 40 5.2
230gb|AC123659.11| Mus musculus chromosome 17, clone RP23-192P18, c... 40 5.2
231gb|AC119190.7| Mus musculus chromosome 8, clone RP24-178B9, comp... 40 5.2
232gb|AC118194.8| Mus musculus chromosome 3, clone RP23-464I9, comp... 40 5.2
233gb|AC137124.17| Mus musculus chromosome 3, clone RP24-229P11, co... 40 5.2
234gb|AC115933.7| Mus musculus chromosome 3, clone RP24-539I8, comp... 40 5.2
235gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete... 40 5.2
236gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete... 40 5.2
237gb|AC069469.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 5.2
238gb|AC138376.11| Mus musculus chromosome 7, clone RP23-53O7, comp... 40 5.2
239gb|AC113283.13| Mus musculus chromosome 3, clone RP23-397I12, co... 40 5.2
240gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's H... 40 5.2
241gb|AC112330.5| Rattus norvegicus 15 BAC CH230-185E8 (Children's ... 40 5.2
242gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's H... 40 5.2
243gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, co... 40 5.2
244gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21... 40 5.2
245gb|AC008346.6| Drosophila melanogaster clone BACR45K04, complete... 40 5.2
246gb|AC138676.9| Mus musculus chromosome 3, clone RP23-381I16, com... 40 5.2
247gb|AC113548.22| Mus musculus chromosome 9, clone RP23-268F15, co... 40 5.2
248gb|AC129552.20| Mus musculus chromosome 5, clone RP24-122N24, co... 40 5.2
249gb|AC117826.10| Mus musculus chromosome 1, clone RP24-81K19, com... 40 5.2
250gb|AC114678.20| Mus musculus chromosome 10, clone RP24-213L12, c... 40 5.2
251gb|AC146610.4| Mus musculus BAC clone RP23-68E7 from chromosome ... 40 5.2
252gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosom... 40 5.2
253gb|AC133496.3| Mus musculus BAC clone RP24-386G2 from chromosome... 40 5.2
254gb|AC127361.4| Mus musculus BAC clone RP23-125M8 from chromosome... 40 5.2
255gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome... 40 5.2
256gb|AC140269.3| Mus musculus BAC clone RP23-322I5 from chromosome... 40 5.2
257gb|AC147122.2| Mus musculus BAC clone RP24-163F9 from chromosome... 40 5.2
258gb|AC150208.1| Pan troglodytes chromosome X clone PTB-043C05 map... 40 5.2
259gb|AC119241.8| Mus musculus chromosome 14, clone RP24-229N19, co... 40 5.2
260ref|NM_172868.2| Mus musculus paralemmin 2 (Palm2), mRNA 40 5.2
261gb|AC122548.10| Mus musculus chromosome 19, clone RP23-273O15, c... 40 5.2
262ref|NM_022740.2| Homo sapiens homeodomain interacting protein ki... 40 5.2
263gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, co... 40 5.2
264gb|AC120845.11| Mus musculus chromosome 3, clone RP23-468E4, com... 40 5.2
265gb|AC121307.7| Mus musculus chromosome 15, clone RP24-209E20, co... 40 5.2
266gb|AC127028.18| Mus musculus chromosome 18, clone RP23-345J21, c... 40 5.2
267gb|AY560661.1| Aspergillus fumigatus protein O-D-mannosyltransfe... 40 5.2
268ref|NM_001006386.2| Gallus gallus lipin 2 (LPIN2), mRNA 40 5.2
269ref|NM_017712.2| Homo sapiens pyroglutamyl-peptidase I (PGPEP1),... 40 5.2
270gb|AC115714.14| Mus musculus chromosome 12, clone RP23-477C24, c... 40 5.2
271gb|AC168278.2| Mus musculus BAC RP24-83C9 (Roswell Park Cancer ... 40 5.2
272gb|AC124719.3| Mus musculus BAC clone RP23-382J10 from chromosom... 40 5.2
273gb|AC140460.3| Mus musculus BAC clone RP24-151D4 from chromosome... 40 5.2
274gb|AC134530.3| Mus musculus BAC clone RP24-507K16 from chromosom... 40 5.2
275gb|AC131798.3| Mus musculus BAC clone RP24-497K17 from chromosom... 40 5.2
276gb|AC090046.10| Mus musculus chromosome 6, clone RP23-82P24, com... 40 5.2
277ref|NG_005542.1| Homo sapiens homeobox C4/C5/C6 cluster (HOXC4/C... 40 5.2
278gb|AC131745.4| Mus musculus BAC clone RP23-55L3 from chromosome ... 40 5.2
279gb|AC125361.4| Mus musculus BAC clone RP23-93M7 from chromosome ... 40 5.2
280gb|AC147047.2| Mus musculus BAC clone RP23-97D19 from chromosome... 40 5.2
281gb|AC129189.3| Mus musculus BAC clone RP24-67O22 from chromosome... 40 5.2
282gb|AC142103.3| Mus musculus BAC clone RP24-287E15 from chromosom... 40 5.2
283gb|AC140471.2| Mus musculus BAC clone RP24-400H5 from chromosome... 40 5.2
284gb|AC147234.3| Mus musculus BAC clone RP24-500F11 from chromosom... 40 5.2
285gb|AC132235.3| Mus musculus BAC clone RP24-497H15 from chromosom... 40 5.2
286gb|AC141426.3| Mus musculus BAC clone RP23-280I14 from chromosom... 40 5.2
287gb|DQ481663.1| Takifugu rubripes HoxAa gene cluster, complete se... 40 5.2
288gb|AC102195.14| Mus musculus chromosome 18, clone RP24-430B21, c... 40 5.2
289gb|AC163013.2| Mus musculus chromosome 8, clone RP24-362N13, com... 40 5.2
290ref|NM_006836.1| Homo sapiens GCN1 general control of amino-acid... 40 5.2
291gb|AC131320.8| Mus musculus chromosome 12, clone RP23-398E18, co... 40 5.2
292gb|AC161490.7| Mus musculus chromosome 7, clone RP23-307M23, com... 40 5.2
293gb|AC131332.12| Mus musculus chromosome 12, clone RP23-480O18, c... 40 5.2
294gb|AC168220.1| Mus musculus BAC clone RP23-77O10 from chromosome... 40 5.2
295gb|AC154605.2| Mus musculus BAC clone RP23-348G3 from chromosome... 40 5.2
296gb|AC139941.9| Mus musculus chromosome 13, clone RP23-78M22, com... 40 5.2
297gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, compl... 40 5.2
298gb|AC164304.2| Mus musculus BAC clone RP23-261B24 from chromosom... 40 5.2
299gb|AC167719.2| Mus musculus BAC clone RP24-285I8 from chromosome... 40 5.2
300gb|AC166157.5| Mus musculus BAC clone RP24-193D9 from chromosome... 40 5.2
301gb|AC167201.6| Mus musculus 10 BAC RP23-402J11 (Roswell Park Can... 40 5.2
302gb|AC123665.9| Mus musculus chromosome 14, clone RP23-226A4, com... 40 5.2
303gb|AC162855.6| Mus musculus chromosome 19, clone RP24-166N3, com... 40 5.2
304gb|AC153378.4| Mus musculus 6 BAC RP23-106C18 (Roswell Park Canc... 40 5.2
305gb|AC122753.11| Mus musculus chromosome 5, clone RP24-492O4, com... 40 5.2
306gb|AC091396.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 5.2
307gb|AC153376.10| Mus musculus 6 BAC RP23-210L10 (Roswell Park Can... 40 5.2
308gb|AC139884.8| Mus musculus chromosome 6, clone RP23-343E20, com... 40 5.2
309gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome... 40 5.2
310gb|AC162920.2| Mus musculus BAC clone RP23-357C16 from chromosom... 40 5.2
311gb|AC164603.4| Mus musculus chromosome 8, clone RP24-114E3, comp... 40 5.2
312gb|AC113476.20| Mus musculus chromosome 17, clone RP23-304J1, co... 40 5.2
313gb|AC122746.7| Mus musculus chromosome 17, clone RP23-144A20, co... 40 5.2
314gb|AC154647.2| Mus musculus BAC clone RP23-283P8 from chromosome... 40 5.2
315gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosom... 40 5.2
316gb|AC155823.8| Mus musculus BAC clone RP23-348C5 from chromosome... 40 5.2
317gb|AC158392.2| Mus musculus BAC clone RP24-87B5 from chromosome ... 40 5.2
318gb|AY728266.1| Trypanosoma cruzi voucher Dm28c zinc finger prote... 40 5.2
319gb|AC158549.8| Mus musculus chromosome 19, clone RP24-216K4, com... 40 5.2
320gb|AC156399.9| Mus musculus 6 BAC RP24-238J9 (Roswell Park Cance... 40 5.2
321gb|AC137585.3| Mus musculus BAC clone RP23-355I23 from chromosom... 40 5.2
322gb|AC124710.4| Mus musculus BAC clone RP24-92A2 from chromosome ... 40 5.2
323gb|AC112686.10| Mus musculus chromosome 6, clone RP23-354N21, co... 40 5.2
324gb|AC005528.43| Mus musculus strain 129S6/SvEvTac clone rp21-493... 40 5.2
325gb|AC133191.3| Mus musculus chromosome 18 clone RP23-390K15, com... 40 5.2
326gb|AC117630.11| Mus musculus chromosome 9, clone RP23-181A16, co... 40 5.2
327gb|AC113244.19| Mus musculus chromosome 19, clone RP23-172E2, co... 40 5.2
328gb|AC067941.7| Homo sapiens BAC clone RP11-815K3 from 7, complet... 40 5.2
329gb|AC100531.15| Mus musculus chromosome 1, clone RP23-147I4, com... 40 5.2
330gb|AC109269.17| Mus musculus chromosome 1, clone RP23-325F17, co... 40 5.2
331ref|XM_899856.2| PREDICTED: Mus musculus vacuolar protein sortin... 40 5.2
332ref|XM_899828.2| PREDICTED: Mus musculus vacuolar protein sortin... 40 5.2
333ref|XM_899860.2| PREDICTED: Mus musculus vacuolar protein sortin... 40 5.2
334ref|XM_620758.3| PREDICTED: Mus musculus vacuolar protein sortin... 40 5.2
335gb|AC011738.4| Homo sapiens BAC clone RP11-36H20 from 7, complet... 40 5.2
336gb|AC114676.7| Mus musculus chromosome 5, clone RP24-211H1, comp... 40 5.2
337gb|AC102668.12| Mus musculus chromosome 6, clone RP23-296I18, co... 40 5.2
338gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, c... 40 5.2
339gb|AC005531.2| Homo sapiens PAC clone RP4-701O16 from 7, complet... 40 5.2
340gb|AC124987.9| Mus musculus chromosome 3, clone RP24-364E17, com... 40 5.2
341gb|AC117678.16| Mus musculus chromosome 6, clone RP23-421M9, com... 40 5.2
342gb|AC012626.10| Homo sapiens chromosome 16 clone CTD-2118O12, co... 40 5.2
343gb|AC123909.2| Homo sapiens chromosome 16 clone RP11-27L11, comp... 40 5.2
344gb|AC124600.5| Mus musculus BAC clone RP23-25H7 from chromosome ... 40 5.2
345gb|AC127315.4| Mus musculus BAC clone RP23-218F21 from chromosom... 40 5.2
346gb|AC132358.3| Mus musculus BAC clone RP24-133O24 from chromosom... 40 5.2
347gb|AC131761.4| Mus musculus BAC clone RP24-228J4 from chromosome... 40 5.2
348gb|AC122345.4| Mus musculus BAC clone RP23-366P9 from chromosome... 40 5.2
349gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome... 40 5.2
350gb|AC125042.4| Mus musculus BAC clone RP23-339G10 from chromosom... 40 5.2
351gb|AC141893.4| Mus musculus BAC clone RP23-324F17 from chromosom... 40 5.2
352emb|CT025604.10| Mouse DNA sequence from clone RP23-332P8 on chr... 40 5.2
353emb|CT010576.9| Mouse DNA sequence from clone RP23-193B21 on chr... 40 5.2
354emb|CT009556.7| Mouse DNA sequence from clone RP23-87H19 on chro... 40 5.2
355gb|AC122395.4| Mus musculus BAC clone RP24-86H17 from chromosome... 40 5.2
356ref|XM_749868.1| Aspergillus fumigatus Af293 protein mannosyltra... 40 5.2
357emb|CR318600.13| Zebrafish DNA sequence from clone DKEY-37F13 in... 40 5.2
358emb|CT009708.6| Mouse DNA sequence from clone RP23-82F10 on chro... 40 5.2
359emb|CT010426.3| Mouse DNA sequence from clone RP23-17A17 on chro... 40 5.2
360gb|AY485310.1| Homo sapiens phospholipase A2, group IVC (cytosol... 40 5.2
361gb|AC103604.4| Mus musculus chromosome 3, clone RP23-95A20, comp... 40 5.2
362gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome... 40 5.2
363gb|AC123828.4| Mus musculus BAC clone RP24-111G17 from chromosom... 40 5.2
364gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosom... 40 5.2
365gb|AC132100.3| Mus musculus BAC clone RP24-294D10 from chromosom... 40 5.2
366gb|AC126935.3| Mus musculus BAC clone RP24-186K24 from chromosom... 40 5.2
367gb|AC132272.3| Mus musculus BAC clone RP24-339P23 from chromosom... 40 5.2
368gb|AC122476.4| Mus musculus BAC clone RP24-334L2 from chromosome... 40 5.2
369gb|AC124393.5| Mus musculus BAC clone RP24-331E1 from chromosome... 40 5.2
370gb|AC104103.5| Mus musculus BAC clone RP24-378I6 from chromosome... 40 5.2
371gb|AC131792.4| Mus musculus BAC clone RP24-468O15 from chromosom... 40 5.2
372gb|AC133076.3| Mus musculus BAC clone RP24-400C14 from chromosom... 40 5.2
373gb|AC131118.4| Mus musculus BAC clone RP24-386M5 from chromosome... 40 5.2
374gb|AC122510.5| Mus musculus BAC clone RP24-445P13 from chromosom... 40 5.2
375gb|AC124345.4| Mus musculus BAC clone RP24-459N19 from chromosom... 40 5.2
376gb|AC132081.3| Mus musculus BAC clone RP24-510O7 from chromosome... 40 5.2
377gb|AC132116.3| Mus musculus BAC clone RP24-158K7 from chromosome... 40 5.2
378gb|AC110090.6| Mus musculus BAC clone RP23-27L4 from chromosome ... 40 5.2
379gb|AC127347.4| Mus musculus BAC clone RP23-54N12 from chromosome... 40 5.2
380gb|AC132141.3| Mus musculus BAC clone RP23-55P19 from chromosome... 40 5.2
381gb|AC141429.4| Mus musculus BAC clone RP23-56L6 from chromosome ... 40 5.2
382gb|AC140375.2| Mus musculus BAC clone RP23-183J2 from chromosome... 40 5.2
383gb|AC123056.4| Mus musculus BAC clone RP23-182H4 from chromosome... 40 5.2
384gb|AC126942.4| Mus musculus BAC clone RP23-174P9 from chromosome... 40 5.2
385gb|AC123871.4| Mus musculus BAC clone RP23-247L8 from chromosome... 40 5.2
386gb|AC122826.4| Mus musculus BAC clone RP23-209L3 from chromosome... 40 5.2
387gb|AC125199.3| Mus musculus BAC clone RP23-261K7 from chromosome... 40 5.2
388gb|AC124748.5| Mus musculus BAC clone RP23-261I7 from chromosome... 40 5.2
389gb|AC126258.4| Mus musculus BAC clone RP23-325B8 from chromosome... 40 5.2
390gb|AC140268.2| Mus musculus BAC clone RP23-321K4 from chromosome... 40 5.2
391gb|AC117275.3| Mus musculus BAC clone RP23-383F11 from chromosom... 40 5.2
392gb|AC125529.4| Mus musculus BAC clone RP23-366O3 from chromosome... 40 5.2
393gb|AC124760.4| Mus musculus BAC clone RP23-133I8 from chromosome... 40 5.2
394gb|AC125374.4| Mus musculus BAC clone RP23-438P19 from chromosom... 40 5.2
395gb|AC122211.4| Mus musculus BAC clone RP23-97F18 from chromosome... 40 5.2
396gb|AC127355.4| Mus musculus BAC clone RP23-96F6 from chromosome ... 40 5.2
397emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 ... 40 5.2
398gb|AC118038.15| Mus musculus chromosome 15, clone RP23-87G17, co... 40 5.2
399gb|AC107770.10| Mus musculus chromosome 5, clone RP23-114M24, co... 40 5.2
400gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosom... 40 5.2
401gb|AC125398.4| Mus musculus BAC clone RP24-217G23 from chromosom... 40 5.2
402gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome... 40 5.2
403gb|AC124401.3| Mus musculus BAC clone RP24-362C2 from chromosome... 40 5.2
404gb|AC122018.4| Mus musculus BAC clone RP24-361O20 from chromosom... 40 5.2
405gb|AC129213.4| Mus musculus BAC clone RP24-391M2 from chromosome... 40 5.2
406gb|AC122492.3| Mus musculus BAC clone RP24-390N7 from chromosome... 40 5.2
407gb|AC125157.4| Mus musculus BAC clone RP24-390G17 from chromosom... 40 5.2
408gb|AC122692.4| Homo sapiens X BAC RP13-675A2 (Roswell Park Cance... 40 5.2
409gb|AC127549.3| Mus musculus BAC clone RP24-510G5 from chromosome... 40 5.2
410gb|AC123026.4| Mus musculus BAC clone RP24-549O22 from chromosom... 40 5.2
411gb|AC117261.4| Mus musculus BAC clone RP24-537K7 from chromosome... 40 5.2
412gb|AC126553.4| Mus musculus BAC clone RP23-448L16 from chromosom... 40 5.2
413gb|AC125071.3| Mus musculus BAC clone RP23-453O8 from chromosome... 40 5.2
414gb|AC121823.3| Mus musculus BAC clone RP23-466I14 from chromosom... 40 5.2
415gb|AC122381.2| Mus musculus BAC clone RP23-477C4 from chromosome... 40 5.2
416gb|AC121826.3| Mus musculus BAC clone RP23-470O13 from chromosom... 40 5.2
417gb|AC121844.2| Mus musculus BAC clone RP24-81L3 from chromosome ... 40 5.2
418gb|AC125039.4| Mus musculus BAC clone RP23-335C3 from chromosome... 40 5.2
419gb|AC123834.4| Mus musculus BAC clone RP24-132N9 from chromosome... 40 5.2
420gb|AC023480.7| Homo sapiens chromosome 3 clone RP11-399K19 map 3... 40 5.2
421gb|AC124504.3| Mus musculus BAC clone RP23-418E15 from chromosom... 40 5.2
422gb|AC125405.4| Mus musculus BAC clone RP23-29M17 from 14, comple... 40 5.2
423gb|AC126249.4| Mus musculus BAC clone RP23-412I9 from chromosome... 40 5.2
424gb|AC121777.3| Mus musculus BAC clone RP23-359A23 from chromosom... 40 5.2
425gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 5.2
426gb|AC122866.4| Mus musculus BAC clone RP23-145J18 from 8, comple... 40 5.2
427gb|AC124573.4| Mus musculus BAC clone RP23-159F13 from 10, compl... 40 5.2
428gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complet... 40 5.2
429gb|AC123951.3| Mus musculus BAC clone RP23-166M23 from 18, compl... 40 5.2
430gb|AC122835.3| Mus musculus BAC clone RP23-187I18 from 3, comple... 40 5.2
431gb|AC127301.3| Mus musculus BAC clone RP23-269N6 from 18, comple... 40 5.2
432gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 40 5.2
433gb|AC116325.5| Mus musculus BAC clone RP23-295K3 from 10, comple... 40 5.2
434gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complet... 40 5.2
435ref|NM_177236.3| Mus musculus ATPase, Ca++ transporting, plasma ... 40 5.2
436gb|AC115825.11| Mus musculus chromosome 9, clone RP23-444E13, co... 40 5.2
437gb|AC098728.3| Mus musculus BAC clone RP23-3H22 from 15, complet... 40 5.2
438gb|AC122924.2| Mus musculus BAC clone RP23-39M16 from 12, comple... 40 5.2
439gb|AC117233.3| Mus musculus BAC clone RP23-408M8 from 6, complet... 40 5.2
440gb|AC125048.2| Mus musculus BAC clone RP23-364E18 from 5, comple... 40 5.2
441gb|AC121877.2| Mus musculus BAC clone RP24-127G8 from 7, complet... 40 5.2
442gb|AC116583.3| Mus musculus BAC clone RP23-348F12 from 6, comple... 40 5.2
443gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, compl... 40 5.2
444gb|AC121610.2| Mus musculus BAC clone RP23-326L12 from 10, compl... 40 5.2
445gb|AC116329.3| Mus musculus BAC clone RP24-290C19 from 5, comple... 40 5.2
446gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, compl... 40 5.2
447gb|AC083946.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 5.2
448gb|AC102783.10| Mus musculus chromosome 14, clone RP23-390K3, co... 40 5.2
449gb|AC098888.4| Mus musculus BAC clone RP23-122N8 from 8, complet... 40 5.2
450gb|AC115690.13| Mus musculus chromosome 12, clone RP24-537M9, co... 40 5.2
451gb|AC113064.8| Mus musculus chromosome 5, clone RP23-262H7, comp... 40 5.2
452gb|AC108410.9| Mus musculus chromosome 7, clone RP23-480A17, com... 40 5.2
453gb|AC113016.7| Mus musculus chromosome 9, clone RP23-181L13, com... 40 5.2
454gb|AC113068.9| Mus musculus chromosome 1, clone RP23-269F19, com... 40 5.2
455gb|AC073111.8| Homo sapiens BAC clone RP11-511P7 from 7, complet... 40 5.2
456gb|AC113528.8| Mus musculus chromosome 18, clone RP23-419F17, co... 40 5.2
457gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, co... 40 5.2
458gb|AC134909.4| Mus musculus chromosome 3 clone RP23-402O2, compl... 40 5.2
459gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, com... 40 5.2
460gb|AC107661.10| Mus musculus chromosome 10, clone RP23-174M1, co... 40 5.2
461gb|AC117624.10| Mus musculus chromosome 8, clone RP23-114M9, com... 40 5.2
462gb|AC110919.10| Mus musculus chromosome 15, clone RP23-216B8, co... 40 5.2
463gb|AC105950.11| Mus musculus chromosome 12, clone RP24-386J17, c... 40 5.2
464gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, com... 40 5.2
465gb|AC165955.3| Mus musculus BAC clone RP23-458A8 from chromosome... 40 5.2
466gb|AC100736.5| Mus musculus chromosome 15, clone RP24-336O6, com... 40 5.2
467gb|AC158751.7| Mus musculus chromosome 7, clone RP23-413C19, com... 40 5.2
468gb|AC164702.2| Mus musculus BAC clone RP23-402H19 from chromosom... 40 5.2
469gb|AC154449.2| Mus musculus BAC clone RP24-168F5 from chromosome... 40 5.2
470gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome... 40 5.2
471gb|AC101663.10| Mus musculus chromosome 1, clone RP23-37L1, comp... 40 5.2
472gb|AC142312.1| Pan troglodytes BAC clone RP43-47K13 from 7, comp... 40 5.2
473gb|AC137677.24| Mus musculus chromosome 1, clone RP23-257D12, co... 40 5.2
474gb|AC097354.12| Mus musculus strain 129/Sv clone ct7-297f7 map X... 40 5.2
475emb|CR388027.14| Zebrafish DNA sequence from clone DKEY-181O16 i... 40 5.2
476gb|AC118728.12| Mus musculus chromosome 1, clone RP24-168F13, co... 40 5.2
477emb|AL163278.2|HS21C078 Homo sapiens chromosome 21 segment HS21C078 40 5.2
478gb|AC158235.3| Mus musculus BAC clone RP23-185P17 from chromosom... 40 5.2
479emb|BX548003.29| Zebrafish DNA sequence from clone DKEY-97I5 in ... 40 5.2
480gb|AC115943.8| Mus musculus chromosome 3, clone RP24-555H23, com... 40 5.2
481emb|CR936925.7| Mouse DNA sequence from clone DN-490M13 on chrom... 40 5.2
482gb|AC148981.7| Mus musculus BAC clone RP23-201L15 from chromosom... 40 5.2
483gb|AC155317.5| Mus musculus BAC clone RP23-89D6 from chromosome ... 40 5.2
484gb|AC163391.4| Mus musculus chromosome 3, clone RP23-173N16, com... 40 5.2
485emb|AL731813.23| Human DNA sequence from clone RP11-354N9 on chr... 40 5.2
486emb|AL031643.1|HS769D20 Human DNA sequence from clone RP4-769D20... 40 5.2
487emb|Z99755.1|HS714B7 Human DNA sequence from clone CTA-714B7 on ... 40 5.2
488emb|AL592151.13| Human DNA sequence from clone RP11-351N5 on chr... 40 5.2
489emb|AL590244.5| Human DNA sequence from clone RP11-28H17 on chro... 40 5.2
490emb|AL513220.9| Human DNA sequence from clone RP11-566C13 on chr... 40 5.2
491emb|AL445473.7| Human DNA sequence from clone RP11-214M7 on chro... 40 5.2
492emb|AL445192.3| Human DNA sequence from clone RP11-269H4 on chro... 40 5.2
493emb|AL365180.13| Human DNA sequence from clone RP13-212J24 on ch... 40 5.2
494emb|AL359643.27| Human DNA sequence from clone RP11-428J1 on chr... 40 5.2
495emb|AL357079.24| Human DNA sequence from clone RP11-7O11 on chro... 40 5.2
496gb|AC091542.3| Felis catus clone RP86-141L11, complete sequence 40 5.2
497emb|AL356773.12| Human DNA sequence from clone RP11-44E24 on chr... 40 5.2
498emb|AL357272.10| Human DNA sequence from clone RP11-111J1 on chr... 40 5.2
499emb|AL356578.22| Human DNA sequence from clone RP11-14G9 on chro... 40 5.2
500emb|AL353697.21| Human DNA sequence from clone RP11-364F8 on chr... 40 5.2

>gb|AY483152.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA2)
            mRNA, complete cds
          Length = 3907

 Score =  694 bits (350), Expect = 0.0
 Identities = 380/389 (97%), Gaps = 7/389 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    gaaaatacaagttgtttcgagtttgtacatacataataatacatcctttgggcaatagca 60
            |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 3829 gaaaatacaagttgtttcgagtttgtacatacataataatacatccttcgggcaatagca 3770

                                                                        
Query: 61   tacagacgacgacagctctcagtttcggctcacttacatacatttttatcctctccattt 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3769 tacagacgacgacagctctcagtttcggctcacttacatacatttttatcctctccattt 3710

                                                                        
Query: 121  aaatcaaggtcaacaaataaagaattgctggctggctggacaatgaaacaacactggaac 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3709 aaatcaaggtcaacaaataaagaattgctggctggctggacaatgaaacaacactggaac 3650

                                                                        
Query: 181  tgactcactgacttgctggctggctggctgtatttctttcttcttcttcgtggccgaact 240
            |||||||||||||||||    ||||||||||||||||   ||||||||||||||||||||
Sbjct: 3649 tgactcactgacttgct----ggctggctgtatttct---ttcttcttcgtggccgaact 3597

                                                                        
Query: 241  gcacagaggtgaaggggttgccgcagcctcccgtctgcccaaatattttgcatatatgag 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3596 gcacagaggtgaaggggttgccgcagcctcccgtctgcccaaatattttgcatatatgag 3537

                                                                        
Query: 301  gcccagctacccaccatggaacaaaaccaataacttaacacttgttgcatgtttgttttc 360
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 3536 gcccagctacccaccatggaacaaaaccaatagcttaacacttgttgcatgtttgttttc 3477

                                         
Query: 361  tatctacacaggggagggagggagggagg 389
            |||||||||||||||||||||||||||||
Sbjct: 3476 tatctacacaggggagggagggagggagg 3448



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                            
Query: 256      ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
                |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 13688408 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 13688464

                           
Query: 316      atggaacaaaa 326
                |||| ||||||
Sbjct: 13688465 atgggacaaaa 13688475



to top

>dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0084P08
          Length = 158656

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                          
Query: 256    ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
              |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 156027 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 156083

                         
Query: 316    atggaacaaaa 326
              |||| ||||||
Sbjct: 156084 atgggacaaaa 156094



to top

>dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0409D09
          Length = 150485

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                         
Query: 256   ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
             |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 39400 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 39456

                        
Query: 316   atggaacaaaa 326
             |||| ||||||
Sbjct: 39457 atgggacaaaa 39467



to top

>dbj|AK121193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086F23, full
            insert sequence
          Length = 4127

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 3691 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 3635

                       
Query: 316  atggaacaaaa 326
            |||| ||||||
Sbjct: 3634 atgggacaaaa 3624



to top

>dbj|AK073561.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042D15, full
            insert sequence
          Length = 4208

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 3773 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 3717

                       
Query: 316  atggaacaaaa 326
            |||| ||||||
Sbjct: 3716 atgggacaaaa 3706



to top

>dbj|AK071976.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013085H01, full
            insert sequence
          Length = 1867

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 1496 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 1440

                       
Query: 316  atggaacaaaa 326
            |||| ||||||
Sbjct: 1439 atgggacaaaa 1429



to top

>dbj|AK067386.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099F14, full
            insert sequence
          Length = 3221

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 2785 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 2729

                       
Query: 316  atggaacaaaa 326
            |||| ||||||
Sbjct: 2728 atgggacaaaa 2718



to top

>dbj|AK062154.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H11, full
            insert sequence
          Length = 1827

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 1391 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 1335

                       
Query: 316  atggaacaaaa 326
            |||| ||||||
Sbjct: 1334 atgggacaaaa 1324



to top

>gb|AC171105.1| Drosophila melanogaster clone CH223-40I08, complete sequence
          Length = 53089

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 178   aactgactcactgacttgctggctggctggctg 210
             |||||||| ||||||| ||||||||||||||||
Sbjct: 25576 aactgactgactgactggctggctggctggctg 25608



to top

>emb|AL031024.1|DMC196F3 Drosophila melanogaster cosmid clone 196F3
          Length = 35835

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 178   aactgactcactgacttgctggctggctggctg 210
             |||||||| ||||||| ||||||||||||||||
Sbjct: 14538 aactgactgactgactggctggctggctggctg 14506



to top

>emb|BX927082.9| Zebrafish DNA sequence from clone DKEY-182O15 in linkage group 13,
             complete sequence
          Length = 157140

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 153   tggctggacaatgaaacaacactgg 177
             |||||||||||||||||||||||||
Sbjct: 68862 tggctggacaatgaaacaacactgg 68886



to top

>ref|NM_130570.2| Drosophila melanogaster CG32810-RB (CG32810), mRNA
          Length = 3270

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 178  aactgactcactgacttgctggctggctggctg 210
            |||||||| ||||||| ||||||||||||||||
Sbjct: 1580 aactgactgactgactggctggctggctggctg 1548



to top

>gb|AY070888.1| Drosophila melanogaster LD45918 full length cDNA
          Length = 1862

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 178 aactgactcactgacttgctggctggctggctg 210
           |||||||| ||||||| ||||||||||||||||
Sbjct: 633 aactgactgactgactggctggctggctggctg 601



to top

>gb|AY069257.1| Drosophila melanogaster GM03763 full length cDNA
          Length = 3282

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 178  aactgactcactgacttgctggctggctggctg 210
            |||||||| ||||||| ||||||||||||||||
Sbjct: 1578 aactgactgactgactggctggctggctggctg 1546



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
             sequence
          Length = 304204

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 178   aactgactcactgacttgctggctggctggctg 210
             |||||||| ||||||| ||||||||||||||||
Sbjct: 55250 aactgactgactgactggctggctggctggctg 55218



to top

>gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, complete sequence
          Length = 192819

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 163480 actgactgactgactggctggctggctggctg 163449



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 163236 actgactgactgactggctggctggctggctg 163205



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 163132 actgactgactgactggctggctggctggctg 163101



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 163484 actgactgactgactgactggctggctggctg 163453



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||| || ||||||||||||||||
Sbjct: 163476 actgactgactggctggctggctggctggctg 163445



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 163240 actgactgactgactgactggctggctggctg 163209



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||| || ||||||||||||||||
Sbjct: 163232 actgactgactggctggctggctggctggctg 163201



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 163136 actgactgactgactgactggctggctggctg 163105



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||| || ||||||||||||||||
Sbjct: 163128 actgactgactggctggctggctggctggctg 163097



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| | ||||||||||||||
Sbjct: 162904 actgactgactgactggttggctggctggctg 162873



to top

>gb|AC158939.9| Mus musculus chromosome 5, clone RP23-204A8, complete sequence
          Length = 218847

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 108847 actgactgactgactggctggctggctggctg 108878



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||| || ||||||||||||||||
Sbjct: 108851 actgactgactggctggctggctggctggctg 108882



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 108843 actgactgactgactgactggctggctggctg 108874



to top

>gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, complete sequence
          Length = 189033

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 195   gctggctggctggctgtatttctttctt 222
             ||||||||||||||||| ||||||||||
Sbjct: 48789 gctggctggctggctgtctttctttctt 48816



to top

>gb|AC124436.5| Mus musculus BAC clone RP24-252O24 from chromosome 10, complete
             sequence
          Length = 174497

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 31718 actgactgactgactggctggctggctggctg 31749



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 31714 actgactgactgactgactggctggctggctg 31745



to top

>emb|BX470191.8| Zebrafish DNA sequence from clone CH211-89N7 in linkage group 7,
             complete sequence
          Length = 181294

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 76351 actgactgactgactggctggctggctggctg 76382



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||| || ||||||||||||||||
Sbjct: 76355 actgactgactggctggctggctggctggctg 76386



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 76347 actgactgactgactgactggctggctggctg 76378



to top

>gb|AE014176.1| Mus musculus piebald deletion region section 4 of 11 of the complete
             sequence
          Length = 395229

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 60909 actgactgactgactggctggctggctggctg 60878



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 60665 actgactgactgactggctggctggctggctg 60634



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 60561 actgactgactgactggctggctggctggctg 60530



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 60913 actgactgactgactgactggctggctggctg 60882



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||| || ||||||||||||||||
Sbjct: 60905 actgactgactggctggctggctggctggctg 60874



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 60669 actgactgactgactgactggctggctggctg 60638



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||| || ||||||||||||||||
Sbjct: 60661 actgactgactggctggctggctggctggctg 60630



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 60565 actgactgactgactgactggctggctggctg 60534



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||| || ||||||||||||||||
Sbjct: 60557 actgactgactggctggctggctggctggctg 60526



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| | ||||||||||||||
Sbjct: 60333 actgactgactgactggttggctggctggctg 60302



to top

>gb|AC104828.4| Homo sapiens BAC clone RP11-804N11 from 4, complete sequence
          Length = 181489

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 273   gtctgcccaaatattttgcatata 296
             ||||||||||||||||||||||||
Sbjct: 85640 gtctgcccaaatattttgcatata 85617



to top

>gb|AC091635.1|AC091635 Drosophila melanogaster, chromosome 2R, region 56F-57A, BAC clone
              BACR10H12, complete sequence
          Length = 166168

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 118827 actgactgactgactggctggctggctggctg 118796



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 118831 actgactgactgactgactggctggctggctg 118800



to top

>gb|AC008347.2|AC008347 Drosophila melanogaster, chromosome 2R, region 57A-57A, BAC clone
             BACR03N16, complete sequence
          Length = 165519

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 12163 actgactgactgactggctggctggctggctg 12132



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 12167 actgactgactgactgactggctggctggctg 12136



to top

>gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome 16, complete sequence
          Length = 240451

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 195   gctggctggctggctgtatttctttctt 222
             ||||||||||||||||| ||||||||||
Sbjct: 23055 gctggctggctggctgtctttctttctt 23028



to top

>emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in linkage group 17,
              complete sequence
          Length = 180659

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 118912 actgactgactgactggctggctggctggctg 118943



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||| || ||||||||||||||||
Sbjct: 118916 actgactgactggctggctggctggctggctg 118947



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 118908 actgactgactgactgactggctggctggctg 118939



to top

>gb|AC145419.3| Dasypus novemcinctus clone VMRC5-468K1, complete sequence
          Length = 151116

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 183   actcactgacttgctggctggctggctg 210
             ||||||| ||||||||||||||||||||
Sbjct: 22113 actcacttacttgctggctggctggctg 22086



to top

>gb|AC154420.2| Mus musculus BAC clone RP24-212L9 from 14, complete sequence
          Length = 159591

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 111528 actgactgactgactggctggctggctggctg 111559



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||| || ||||||||||||||||
Sbjct: 111532 actgactgactggctggctggctggctggctg 111563



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 111524 actgactgactgactgactggctggctggctg 111555



to top

>gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58 of 73 of the complete
              sequence
          Length = 256764

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| ||||||||||||||||
Sbjct: 173756 actgactgactgactggctggctggctggctg 173725



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| |||||||  |||||||||||||||
Sbjct: 173760 actgactgactgactgactggctggctggctg 173729



to top

>gb|AC004250.1|AC004250 Drosophila melanogaster (P1 DS05897 (D171)) DNA sequence, complete
             sequence
          Length = 39471

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 22475 actgactgactgactggctggctggctggctg 22506



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 22471 actgactgactgactgactggctggctggctg 22502



to top

>gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, complete sequence
          Length = 207157

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| ||||||| ||||||||||||||||
Sbjct: 72324 actgactgactgactggctggctggctggctg 72293



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||||||  |||||||||||||||
Sbjct: 72328 actgactgactgactgactggctggctggctg 72297



to top

>gb|AC156987.7| Mus musculus chromosome 7, clone RP23-78K13, complete sequence
          Length = 231140

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 195    gctggctggctggctgtatttctttcttctt 225
              ||||||||||||||| | |||||||||||||
Sbjct: 191787 gctggctggctggctttctttctttcttctt 191817



to top

>gb|AC122230.4| Mus musculus BAC clone RP23-133F23 from 9, complete sequence
          Length = 183554

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 367    cacaggggagggagggagggagg 389
              |||||||||||||||||||||||
Sbjct: 180416 cacaggggagggagggagggagg 180438



to top

>gb|AC161114.4| Mus musculus BAC clone RP24-338A5 from chromosome 12, complete sequence
          Length = 220746

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 184    ctcactgacttgctggctggctggctg 210
              |||||||||| ||||||||||||||||
Sbjct: 208459 ctcactgactggctggctggctggctg 208433



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 52523 aggggagggagggagggagg 52542



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
           complete sequence
          Length = 127259

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 367 cacaggggagggagggagggagg 389
           |||||||||||||||||||||||
Sbjct: 244 cacaggggagggagggagggagg 222



to top

>emb|AL731613.5|OSJN00257 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0065H10,
              complete sequence
          Length = 133967

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 367    cacaggggagggagggagggagg 389
              |||||||||||||||||||||||
Sbjct: 128895 cacaggggagggagggagggagg 128873



to top

>dbj|AK078692.1| Mus musculus adult male eyeball cDNA, RIKEN full-length enriched
            library, clone:7530414M05 product:unclassifiable, full
            insert sequence
          Length = 2291

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 184  ctcactgacttgctggctggctggctg 210
            |||||||||| ||||||||||||||||
Sbjct: 1657 ctcactgactggctggctggctggctg 1631



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 367      cacaggggagggagggagggagg 389
                |||||||||||||||||||||||
Sbjct: 27476268 cacaggggagggagggagggagg 27476246



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 370      aggggagggagggagggagg 389
                ||||||||||||||||||||
Sbjct: 29536445 aggggagggagggagggagg 29536464



to top

>gb|AC157213.2| Mus musculus BAC clone RP23-157N5 from chromosome 12, complete sequence
          Length = 211304

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 184   ctcactgacttgctggctggctggctg 210
             |||||||||| ||||||||||||||||
Sbjct: 76446 ctcactgactggctggctggctggctg 76420



to top

>gb|AC139378.4| Mus musculus BAC clone RP23-265F20 from 9, complete sequence
          Length = 256632

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 367    cacaggggagggagggagggagg 389
              |||||||||||||||||||||||
Sbjct: 110279 cacaggggagggagggagggagg 110257



to top

>gb|AC132407.3| Mus musculus BAC clone RP23-343G12 from 8, complete sequence
          Length = 205357

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 367   cacaggggagggagggagggagg 389
             |||||||||||||||||||||||
Sbjct: 59933 cacaggggagggagggagggagg 59955



to top

>emb|AL831746.5| Mouse DNA sequence from clone RP23-67O11 on chromosome 4, complete
              sequence
          Length = 239570

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 180    ctgactcactgacttgctggctggctggctg 210
              |||||| ||||||| ||||||||||||||||
Sbjct: 145721 ctgactgactgactggctggctggctggctg 145751



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              |||||||  |||||| ||||||||||||||||
Sbjct: 145780 actgactggctgactggctggctggctggctg 145811



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 179    actgactcactgacttgctggctggctggctg 210
              ||||||| ||||||| |||| |||||||||||
Sbjct: 145772 actgactgactgactggctgactggctggctg 145803



to top

>emb|AL035331.1|DMC33C11 Drosophila melanogaster cosmid clone 33C11
          Length = 37005

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 180  ctgactcactgacttgctggctggctggctg 210
            |||||| ||||||| ||||||||||||||||
Sbjct: 9591 ctgactgactgactggctggctggctggctg 9561



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 179  actgactcactgacttgctggctggctggctg 210
            ||||||| |||| || ||||||||||||||||
Sbjct: 9588 actgactgactggctggctggctggctggctg 9557



to top

>gb|AC114993.18| Mus musculus chromosome 5, clone RP23-42D10, complete sequence
          Length = 208968

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 95634 acaggggagggagggagggagg 95655



to top

>gb|AC163351.2| Mus musculus BAC clone RP23-150D4 from chromosome 13, complete sequence
          Length = 214062

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 366    acacaggggagggagggaggga 387
              ||||||||||||||||||||||
Sbjct: 193422 acacaggggagggagggaggga 193401



to top

>gb|AC139293.4| Mus musculus BAC clone RP24-381N4 from chromosome 8, complete
            sequence
          Length = 161248

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 196  ctggctggctggctgtatttct 217
            ||||||||||||||||||||||
Sbjct: 4518 ctggctggctggctgtatttct 4497



to top

>gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, complete sequence
          Length = 163721

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 94095 acaggggagggagggagggagg 94074



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 198  ggctggctggctgtatttctttct 221
            |||||||||||||| |||||||||
Sbjct: 3005 ggctggctggctgtctttctttct 2982



to top

>ref|NM_001030622.1| Gallus gallus kinesin family member 3A (KIF3A), mRNA
          Length = 4163

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 204  ctggctgtatttctttcttcttcttc 229
            |||||| |||||||||||||||||||
Sbjct: 1421 ctggctttatttctttcttcttcttc 1396



to top

>gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosome 8, complete sequence
          Length = 196497

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 195    gctggctggctggctgtatttctttcttct 224
              ||||||||||||||| | ||||||||||||
Sbjct: 109965 gctggctggctggctttctttctttcttct 109936



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 195    gctggctggctggctgtatttctttctt 222
              ||||||||||||||||  ||||||||||
Sbjct: 109969 gctggctggctggctggctttctttctt 109942



to top

>ref|XM_414646.1| PREDICTED: Gallus gallus similar to Kinesin-like protein KIF3A
           (Microtubule plus end-directed kinesin motor 3A)
           (LOC416331), mRNA
          Length = 1218

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 204 ctggctgtatttctttcttcttcttc 229
           |||||| |||||||||||||||||||
Sbjct: 403 ctggctttatttctttcttcttcttc 378



to top

>gb|AC123731.9| Mus musculus chromosome 15, clone RP23-458N23, complete sequence
          Length = 178222

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 367    cacaggggagggagggagggag 388
              ||||||||||||||||||||||
Sbjct: 175806 cacaggggagggagggagggag 175827



to top

>gb|AC158789.4| Mus musculus chromosome 5, clone RP23-192C21, complete sequence
          Length = 218871

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 122451 acaggggagggagggagggagg 122430



to top

>gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
             OSJNBa0082F22, complete sequence
          Length = 176038

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 84173 acaggggagggagggagggagg 84194



to top

>gb|AC163668.5| Mus musculus BAC clone RP23-32P22 from chromosome 1, complete sequence
          Length = 222156

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 364    ctacacaggggagggagggagggagg 389
              |||||||| |||||||||||||||||
Sbjct: 211424 ctacacagaggagggagggagggagg 211399



to top

>gb|AC155728.13| Mus musculus 6 BAC RP24-162H1 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 176377

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 208   ctgtatttctttcttcttcttc 229
             ||||||||||||||||||||||
Sbjct: 83827 ctgtatttctttcttcttcttc 83848



to top

>gb|AC122402.2| Mus musculus BAC clone RP24-108B4 from chromosome 13, complete sequence
          Length = 175669

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 366   acacaggggagggagggaggga 387
             ||||||||||||||||||||||
Sbjct: 84032 acacaggggagggagggaggga 84053



to top

>gb|AC119395.2| Mus musculus chromosome 8 clone MGS1-178N23 map A3, complete sequence
          Length = 92300

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 367   cacaggggagggagggagggag 388
             ||||||||||||||||||||||
Sbjct: 36086 cacaggggagggagggagggag 36065



to top

>gb|AC112151.3| Mus musculus BAC clone RP24-86M8 from 2, complete sequence
          Length = 216515

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 26151 acaggggagggagggagggagg 26172



to top

>gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, complete sequence
          Length = 199240

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 19536 acaggggagggagggagggagg 19557



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 198    ggctggctggctgtatttctttct 221
              |||||||||||||| |||||||||
Sbjct: 110624 ggctggctggctgtctttctttct 110647



to top

>gb|U40427.1| Caenorhabditis elegans cosmid F43C9, complete sequence
          Length = 34037

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 23    ttgtacatacataataatacat 44
             ||||||||||||||||||||||
Sbjct: 13831 ttgtacatacataataatacat 13810



to top

>gb|AC161413.5| Mus musculus chromosome 19, clone RP23-106D17, complete sequence
          Length = 215356

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 111532 acaggggagggagggagggagg 111511



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 198   ggctggctggctgtatttctttct 221
             |||||||||||||| |||||||||
Sbjct: 20438 ggctggctggctgtctttctttct 20415



to top

>gb|AC146154.3| Pan troglodytes BAC clone RP43-37E8 from 7, complete sequence
          Length = 240699

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 368  acaggggagggagggagggagg 389
            ||||||||||||||||||||||
Sbjct: 5796 acaggggagggagggagggagg 5775



to top

>emb|AL162274.17| Human DNA sequence from clone RP11-45A17 on chromosome 10 Contains the
             BNIP3 gene for BCL2/adenovirus E1B 19kD-interacting
             protein 3, the 5' end of a novel gene, possible ortholog
             of mouse RIKEN cDNA 6330417G02 geneand CpG islands,
             complete sequence
          Length = 148891

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 54135 acaggggagggagggagggagg 54114



to top

>emb|AL160058.8| Human DNA sequence from clone RP11-280O1 on chromosome 1 Contains the 5'
              end of the LMX1A gene for alpha LIM homeobox transcription
              factor 1, the RXRG gene for gamma retinoid X receptor, the
              3' end of a novel gene (FLJ35813) and two CpG islands,
              complete sequence
          Length = 155369

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 140538 acaggggagggagggagggagg 140559



to top

>emb|AL049634.8|HSJ576H24 Human DNA sequence from clone RP4-576H24 on chromosome 20 Contains the
             PTPNS1L12 gene for protein tyrosine phosphatase
             (non-receptor type substrate 1-like 2), a PTPNS pseudogene
             and part of the SIRPB1 gene for signal regulatory protein
             beta 1, complete sequence
          Length = 115478

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 15814 acaggggagggagggagggagg 15793



to top

>gb|AC127142.3| Rattus norvegicus 4 BAC CH230-41K13 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 238669

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 132809 acaggggagggagggagggagg 132788



to top

>emb|AL591174.13| Mouse DNA sequence from clone RP23-271B20 on chromosome 11, complete
              sequence
          Length = 205379

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 105195 acaggggagggagggagggagg 105174



to top

>emb|AJ851728.1| Gallus gallus mRNA for hypothetical protein, clone 22e2
          Length = 4163

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 204  ctggctgtatttctttcttcttcttc 229
            |||||| |||||||||||||||||||
Sbjct: 1421 ctggctttatttctttcttcttcttc 1396



to top

>emb|BX005100.9| Mouse DNA sequence from clone RP23-76P22 on chromosome 11 Contains part
              of the gene for a novel protein (C230094A16Rik), the gene
              for a novel protein (4931440F15Rik) similar to Mus musculus
              feminization 1 homolog a (C. elegans) (Fem1a), a ribosomal
              protein L23 (Rpl23) pseudogene, a preferentially expressed
              antigen in melanoma like 5 (Pramel5) pseudogene and a CpG
              island, complete sequence
          Length = 193116

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 190017 acaggggagggagggagggagg 189996



to top

>emb|AJ621737.1| Gallus gallus partial KIF3A gene for kinesin-like protein KIF3A,
            exons 10-12, BAC bW075D23 clone, contig 3
          Length = 1950

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 204  ctggctgtatttctttcttcttcttc 229
            |||||| |||||||||||||||||||
Sbjct: 1507 ctggctttatttctttcttcttcttc 1532



to top

>emb|CR354750.1| Mus musculus chromosome 6, clone tr151 strain 129/Sv, complete sequence
          Length = 167508

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 208   ctgtatttctttcttcttcttc 229
             ||||||||||||||||||||||
Sbjct: 72367 ctgtatttctttcttcttcttc 72388



to top

>gb|AC107624.1| Homo sapiens chromosome 3 clone RP11-744H21, complete sequence
          Length = 170282

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 96683 acaggggagggagggagggagg 96704



to top

>gb|AC099779.2| Homo sapiens chromosome 3 clone RP11-760G13, complete sequence
          Length = 198235

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 368  acaggggagggagggagggagg 389
            ||||||||||||||||||||||
Sbjct: 3149 acaggggagggagggagggagg 3128



to top

>gb|DQ099567.1| Taenia pisiformis isolate KAP701 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, partial sequence
          Length = 404

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 185 tcactgacttgctggctggctggctg 210
           ||||||||| ||||||||||||||||
Sbjct: 89  tcactgactggctggctggctggctg 64



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 368      acaggggagggagggagggagg 389
                ||||||||||||||||||||||
Sbjct: 29641284 acaggggagggagggagggagg 29641305



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 368      acaggggagggagggagggagg 389
                ||||||||||||||||||||||
Sbjct: 13121396 acaggggagggagggagggagg 13121417



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 368      acaggggagggagggagggagg 389
                ||||||||||||||||||||||
Sbjct: 31590430 acaggggagggagggagggagg 31590451



to top

>gb|AC122764.12| Mus musculus chromosome 15, clone RP24-93B16, complete sequence
          Length = 209493

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 367    cacaggggagggagggagggag 388
              ||||||||||||||||||||||
Sbjct: 165508 cacaggggagggagggagggag 165487



to top

>gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, region 96B-96C, BAC clone
             BACR03L02, complete sequence
          Length = 162921

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 177   gaactgactcactgacttgctggctggctggctg 210
             ||||||||| |||| || ||||||||||||||||
Sbjct: 41258 gaactgactgactggctggctggctggctggctg 41291



to top

>gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, region 96B-96B, BAC clone
              BACR03I15, complete sequence
          Length = 181132

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 177    gaactgactcactgacttgctggctggctggctg 210
              ||||||||| |||| || ||||||||||||||||
Sbjct: 104590 gaactgactgactggctggctggctggctggctg 104623



to top

>dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0503C12
          Length = 147180

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 368  acaggggagggagggagggagg 389
            ||||||||||||||||||||||
Sbjct: 4162 acaggggagggagggagggagg 4183



to top

>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0435B05
          Length = 150997

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 103453 acaggggagggagggagggagg 103474



to top

>gb|AC079183.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-258N2, complete
              sequence
          Length = 170233

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 368    acaggggagggagggagggagg 389
              ||||||||||||||||||||||
Sbjct: 161382 acaggggagggagggagggagg 161361



to top

>dbj|AP005463.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0712G01
          Length = 87056

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 14398 acaggggagggagggagggagg 14419



to top

>dbj|AP004329.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OJ1663_H12
          Length = 125422

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 84869 acaggggagggagggagggagg 84890



to top

>gb|AC124129.13| Mus musculus chromosome 5, clone RP23-198B3, complete sequence
          Length = 197543

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 74521 acaggggagggagggagggagg 74542



to top

>emb|AL928733.14| Mouse DNA sequence from clone RP23-190O13 on chromosome 2, complete
             sequence
          Length = 110511

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 73307 acaggggagggagggagggagg 73328



to top

>gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88 of 118 of the
             complete sequence
          Length = 227219

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 177   gaactgactcactgacttgctggctggctggctg 210
             ||||||||| |||| || ||||||||||||||||
Sbjct: 63777 gaactgactgactggctggctggctggctggctg 63810



to top

>gb|AC171917.14| Mus musculus chromosome 8, clone RP23-390K13, complete sequence
          Length = 217234

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 196    ctggctggctggctgtatttct 217
              ||||||||||||||||||||||
Sbjct: 183118 ctggctggctggctgtatttct 183097



to top

>gb|AC171678.8| Mus musculus chromosome 8, clone RP24-104E12, complete sequence
          Length = 175681

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 196   ctggctggctggctgtatttct 217
             ||||||||||||||||||||||
Sbjct: 92049 ctggctggctggctgtatttct 92028



to top

>gb|AC134435.3| Mus musculus BAC clone RP24-423J19 from 1, complete sequence
          Length = 225687

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 364   ctacacaggggagggagggagggagg 389
             |||||||| |||||||||||||||||
Sbjct: 53528 ctacacagaggagggagggagggagg 53503



to top

>gb|AC159985.2| Gallus gallus BAC clone CH261-18F10 from chromosome unknown, complete
              sequence
          Length = 211288

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 204    ctggctgtatttctttcttcttcttc 229
              |||||| |||||||||||||||||||
Sbjct: 107749 ctggctttatttctttcttcttcttc 107724



to top

>gb|AC131685.4| Mus musculus BAC clone RP23-372G24 from 1, complete sequence
          Length = 163474

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 364   ctacacaggggagggagggagggagg 389
             |||||||| |||||||||||||||||
Sbjct: 65938 ctacacagaggagggagggagggagg 65913



to top

>emb|AL669855.20| Mouse DNA sequence from clone RP23-82I5 on chromosome 11, complete
             sequence
          Length = 207991

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 76243 acaggggagggagggagggagg 76264



to top

>emb|AL671964.7| Mouse DNA sequence from clone RP23-198N23 on chromosome 11, complete
             sequence
          Length = 93281

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 29489 acaggggagggagggagggagg 29510



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 368   acaggggagggagggagggagg 389
             ||||||||||||||||||||||
Sbjct: 29467 acaggggagggagggagggagg 29488



to top

>gb|AC164069.9| Mus musculus chromosome 15, clone RP23-422H17, complete sequence
          Length = 216364

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 41964 caggggagggagggagggagg 41984



to top

>gb|AC163689.3| Mus musculus BAC clone CH36-200G6 from chromosome 13, complete sequence
          Length = 188084

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 181244 caggggagggagggagggagg 181224



to top

>gb|AC167720.2| Mus musculus BAC clone RP24-216G15 from chromosome 16, complete sequence
          Length = 172721

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 365    tacacaggggagggagggagggagg 389
              |||||| ||||||||||||||||||
Sbjct: 172195 tacacaagggagggagggagggagg 172171



to top

>ref|XM_470347.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3905

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 3474 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 3419

                       
Query: 316  atggaacaaaa 326
            |||||||||||
Sbjct: 3418 atggaacaaaa 3408



to top

>gb|AF110520.1|MMHC425O18 Mus musculus major histocompatibility complex region NG27, NG28, RPS28,
              NADH oxidoreductase, NG29, KIFC1, Fas-binding protein,
              BING1, tapasin, RalGDS-like, KE2, BING4, beta
              1,3-galactosyl transferase, and RPS18 genes, complete cds;
              Sacm21 gene, partial cds; and unknown gene
          Length = 213245

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 109017 caggggagggagggagggagg 109037



to top

>gb|AF380987.1| Musca domestica microsatellite MdCA224 sequence
          Length = 284

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 190 gacttgctggctggctggctgtatt 214
           |||| ||||||||||||||||||||
Sbjct: 260 gactggctggctggctggctgtatt 284



to top

>gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosome 7, complete sequence
          Length = 238433

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 132353 caggggagggagggagggagg 132333



to top

>gb|AC131919.13| Mus musculus chromosome 15, clone RP24-239J20, complete sequence
          Length = 177896

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 147269 caggggagggagggagggagg 147249



to top

>gb|AC135079.9| Mus musculus chromosome 15, clone RP24-439P7, complete sequence
          Length = 155778

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 136035 caggggagggagggagggagg 136055



to top

>gb|AC147992.3| Mus musculus BAC clone RP24-384K8 from chromosome 18, complete sequence
          Length = 239075

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 175923 caggggagggagggagggagg 175903



to top

>gb|AC107764.11| Mus musculus chromosome 15, clone RP23-179A6, complete sequence
          Length = 196178

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 94446 caggggagggagggagggagg 94426



to top

>gb|AC125446.12| Mus musculus chromosome 14, clone RP24-501J23, complete sequence
          Length = 159722

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 365   tacacaggggagggagggagggagg 389
             ||||||||| |||||||||||||||
Sbjct: 76459 tacacagggaagggagggagggagg 76483



to top

>gb|AC124998.10| Mus musculus chromosome 10, clone RP24-350B12, complete sequence
          Length = 185801

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 148176 caggggagggagggagggagg 148156



to top

>gb|BC004079.1| Mus musculus mercaptopyruvate sulfurtransferase, mRNA (cDNA clone
            MGC:8271 IMAGE:3592659), complete cds
          Length = 1275

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 369  caggggagggagggagggagg 389
            |||||||||||||||||||||
Sbjct: 1134 caggggagggagggagggagg 1154



to top

>gb|AC110883.12| Mus musculus chromosome 8, clone RP23-200N24, complete sequence
          Length = 293104

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 365   tacacaggggagggagggagggagg 389
             |||| ||||||||||||||||||||
Sbjct: 94474 tacaaaggggagggagggagggagg 94450



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                            
Query: 256      ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
                ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 34878997 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 34878942

                           
Query: 316      atggaacaaaa 326
                |||||||||||
Sbjct: 34878941 atggaacaaaa 34878931



to top

>gb|AC126029.3| Mus musculus BAC clone RP23-389K5 from chromosome 19, complete sequence
          Length = 212472

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 55642 caggggagggagggagggagg 55622



to top

>gb|AC124432.5| Mus musculus BAC clone RP24-243L15 from chromosome 18, complete
             sequence
          Length = 160728

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 65594 caggggagggagggagggagg 65614



to top

>gb|AC132268.3| Mus musculus BAC clone RP24-399H6 from chromosome 19, complete sequence
          Length = 191573

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 110683 caggggagggagggagggagg 110663



to top

>gb|AC125044.3| Mus musculus BAC clone RP23-348B10 from chromosome 17, complete sequence
          Length = 222615

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 127633 caggggagggagggagggagg 127653



to top

>gb|AC121838.2| Mus musculus BAC clone RP24-74O18 from 1, complete sequence
          Length = 180961

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 96958 caggggagggagggagggagg 96978



to top

>gb|AC114569.7| Mus musculus chromosome 6, clone RP23-139J6, complete sequence
          Length = 179927

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 45217 caggggagggagggagggagg 45237



to top

>emb|Z81311.1|HSU244G10 Human DNA sequence from clone LL0XNC01-244G10 on chromosome Xq26-27.1
             Contains a melanoma antigen, family A, 11 (MAGEA11)
             pseudogene and a tau tubulin kinase pseudogene, complete
             sequence
          Length = 43927

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tgtatttctttcttcttcttc 229
             |||||||||||||||||||||
Sbjct: 12128 tgtatttctttcttcttcttc 12148



to top

>emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on chromosome 10 Contains a
              ribosomal protein L17 (RPL17) pseudogene and the 3'end of
              the FER1L3 gene for fer-1-like 3, myoferlin (C. elegans),
              complete sequence
          Length = 173864

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 209    tgtatttctttcttcttcttc 229
              |||||||||||||||||||||
Sbjct: 153643 tgtatttctttcttcttcttc 153663



to top

>emb|AL033519.42|HS340B19 Human DNA sequence from clone RP3-340B19 on chromosome 6p21.2-21.3
             Contains the TULP1 gene for tubby like protein 1, a novel
             gene, ribosomal protein S15A (RPS15A) and L36 (RPL36)
             pseudogenes, the 3' end of the FKBP5 gene for FK506
             binding protein 5 (FKBP51) and two CpG islands, complete
             sequence
          Length = 178985

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 38831 caggggagggagggagggagg 38811



to top

>emb|AL669822.10| Mouse DNA sequence from clone RP23-47J12 on chromosome 11 Contains the
             5' end of the Cobl gene for cordon-bleu and a CpG island,
             complete sequence
          Length = 137869

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 49957 caggggagggagggagggagg 49977



to top

>emb|AL591496.13| Mouse DNA sequence from clone RP23-384C18 on chromosome 11 Contains the
             3' end of a novel gene, five novel genes, the Serpinf1 and
             Serpinf2 genes for serine (or cysteine) proteinase
             inhibitor, clade F) members 1 and 2, an H+ transporting
             mitochondrial F0 complex ATP synthase subunit c (subunit
             9) isoform 1 (Atp5g1) pseudogene, the Prpf8 gene for
             pre-mRNA processing factor 8, the gene for the ortholog of
             human scavenger receptor class F member 1 SCARF1, the 5'
             end of the gene for novel protein similar to solute
             carrier family 43 member 1 Slc43a1 and seven CpG islands,
             complete sequence
          Length = 205633

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 15057 caggggagggagggagggagg 15077



to top

>gb|AC154233.3| Mus musculus BAC clone RP24-345G9 from chromosome 16, complete sequence
          Length = 178248

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 365   tacacaggggagggagggagggagg 389
             |||||| ||||||||||||||||||
Sbjct: 18674 tacacaagggagggagggagggagg 18650



to top

>emb|AL591143.11| Mouse DNA sequence from clone RP23-210L24 on chromosome 11 Contains the
              5' end of the Abr gene for active BCR-related protein, a
              ribosomal protein L18 (Rpl18) pseudogene, a ribosomal
              protein L36 (Rpl36) pseudogene and four CpG islands,
              complete sequence
          Length = 212940

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 118790 caggggagggagggagggagg 118770



to top

>emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on chromosome 11 Contains a
             Friedreich ataxia protein (Frda) pseudogene, complete
             sequence
          Length = 203970

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 368   acaggggagggagggagggag 388
             |||||||||||||||||||||
Sbjct: 62233 acaggggagggagggagggag 62213



to top

>gb|AC171138.2| Helobdella robusta clone CH306-1A9, complete sequence
          Length = 97729

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 182   gactcactgacttgctggctggctggctg 210
             |||| ||||||| ||||||||||||||||
Sbjct: 20061 gactgactgactggctggctggctggctg 20089



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 179   actgactcactgacttgctggctggctggctg 210
             ||||||| |||| || ||||||||||||||||
Sbjct: 20062 actgactgactggctggctggctggctggctg 20093



to top

>emb|BX004828.21| Zebrafish DNA sequence from clone DKEY-185M8, complete sequence
          Length = 161870

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 209    tgtatttctttcttcttcttc 229
              |||||||||||||||||||||
Sbjct: 117680 tgtatttctttcttcttcttc 117700



to top

>gb|AC100868.2| Homo sapiens chromosome 8, clone RP11-246K8, complete sequence
          Length = 160939

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 121787 caggggagggagggagggagg 121767



to top

>dbj|AK136571.1| Mus musculus adult male cecum cDNA, RIKEN full-length enriched
            library, clone:9130405K21 product:mercaptopyruvate
            sulfurtransferase, full insert sequence
          Length = 1314

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 369  caggggagggagggagggagg 389
            |||||||||||||||||||||
Sbjct: 1188 caggggagggagggagggagg 1208



to top

>emb|AL672153.3| Mouse DNA sequence from clone RP23-8C14 on chromosome 2, complete
             sequence
          Length = 137628

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 76921 caggggagggagggagggagg 76901



to top

>emb|BX890623.6| Mouse DNA sequence from clone RP23-83O23 on chromosome 2, complete
              sequence
          Length = 226542

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 184179 caggggagggagggagggagg 184199



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                            
Query: 256      ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
                ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 34969069 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 34969014

                           
Query: 316      atggaacaaaa 326
                |||||||||||
Sbjct: 34969013 atggaacaaaa 34969003



to top

>gb|AC008331.7|AC008331 Drosophila melanogaster, chromosome 2L, region 29D-29E, BAC clone
              BACR02B16, complete sequence
          Length = 186938

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 178    aactgactcactgacttgctggctggctg 206
              |||||||| ||||||| ||||||||||||
Sbjct: 139925 aactgactgactgactggctggctggctg 139897



to top

>gb|BC094469.1| Mus musculus mercaptopyruvate sulfurtransferase, mRNA (cDNA clone
            MGC:102356 IMAGE:5009481), complete cds
          Length = 1438

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 369  caggggagggagggagggagg 389
            |||||||||||||||||||||
Sbjct: 1293 caggggagggagggagggagg 1313



to top

>gb|AC007330.6|AC007330 Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone
              BACR30G11, complete sequence
          Length = 166854

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 178    aactgactcactgacttgctggctggctggctg 210
              |||||||| | ||||| ||||||||||||||||
Sbjct: 139290 aactgactgattgactggctggctggctggctg 139258



to top

>gb|AC007413.5|AC007413 Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone
             BACR01L01, complete sequence
          Length = 160301

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 178   aactgactcactgacttgctggctggctggctg 210
             |||||||| | ||||| ||||||||||||||||
Sbjct: 94372 aactgactgattgactggctggctggctggctg 94340



to top

>emb|BX679659.7| Mouse DNA sequence from clone RP23-125B17 on chromosome 2, complete
             sequence
          Length = 44688

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 42369 caggggagggagggagggagg 42349



to top

>gb|AC106876.3| Homo sapiens BAC clone RP11-512N9 from 2, complete sequence
          Length = 116305

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 31155 caggggagggagggagggagg 31135



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 31094 aggggagggagggagggagg 31075



to top

>gb|AC104487.3| Oryza sativa chromosome 3 BAC OSJNBa0042I09 genomic sequence, complete
              sequence
          Length = 171376

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Plus

                                                                          
Query: 256    ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
              ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 136483 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 136538

                         
Query: 316    atggaacaaaa 326
              |||||||||||
Sbjct: 136539 atggaacaaaa 136549



to top

>gb|AC008939.8| Homo sapiens chromosome 5 clone CTD-2316B1, complete sequence
          Length = 112755

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 239   ctgcacagaggtgaaggggtt 259
             |||||||||||||||||||||
Sbjct: 72266 ctgcacagaggtgaaggggtt 72286



to top

>gb|AC090907.14| Homo sapiens chromosome 15, clone RP11-505E24, complete sequence
          Length = 128503

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 42858 caggggagggagggagggagg 42838



to top

>emb|AL928824.13| Zebrafish DNA sequence from clone CH211-105D18 in linkage group 6,
             complete sequence
          Length = 189742

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 209   tgtatttctttcttcttcttc 229
             |||||||||||||||||||||
Sbjct: 18694 tgtatttctttcttcttcttc 18674



to top

>dbj|AK100877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127C10, full
            insert sequence
          Length = 4029

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 3644 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 3589

                       
Query: 316  atggaacaaaa 326
            |||||||||||
Sbjct: 3588 atggaacaaaa 3578



to top

>dbj|AK101178.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033029A22, full
            insert sequence
          Length = 2325

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                        
Query: 256  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
            ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 2271 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 2216

                       
Query: 316  atggaacaaaa 326
            |||||||||||
Sbjct: 2215 atggaacaaaa 2205



to top

>emb|CT573036.11| Mouse DNA sequence from clone RP24-376I11 on chromosome 9, complete
             sequence
          Length = 136639

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 14576 caggggagggagggagggagg 14596



to top

>dbj|AK060814.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-H07, full
           insert sequence
          Length = 1180

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                       
Query: 256 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 315
           ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 791 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 736

                      
Query: 316 atggaacaaaa 326
           |||||||||||
Sbjct: 735 atggaacaaaa 725



to top

>gb|AC105165.11| Mus musculus chromosome 18, clone RP24-302C24, complete sequence
          Length = 186431

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 75659 caggggagggagggagggagg 75639



to top

>emb|CT030732.13| Mouse DNA sequence from clone RP23-27D5 on chromosome 17, complete
              sequence
          Length = 220163

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 171585 caggggagggagggagggagg 171605



to top

>gb|AE003622.4| Drosophila melanogaster chromosome 2L, section 31 of 83 of the complete
             sequence
          Length = 262557

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 178   aactgactcactgacttgctggctggctg 206
             |||||||| ||||||| ||||||||||||
Sbjct: 51603 aactgactgactgactggctggctggctg 51575



to top

>gb|AE003831.3| Drosophila melanogaster chromosome 2R, section 19 of 73 of the complete
             sequence
          Length = 275390

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 178   aactgactcactgacttgctggctggctggctg 210
             |||||||| | ||||| ||||||||||||||||
Sbjct: 80218 aactgactgattgactggctggctggctggctg 80186



to top

>emb|AL928856.5| Mouse DNA sequence from clone RP23-413G24 on chromosome 2, complete
             sequence
          Length = 108193

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 96959 caggggagggagggagggagg 96979



to top

>gb|AC110519.13| Mus musculus chromosome 8, clone RP23-183M15, complete sequence
          Length = 217236

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 95628 caggggagggagggagggagg 95648



to top

>emb|AL840625.9| Mouse DNA sequence from clone RP23-343F17 on chromosome 4, complete
              sequence
          Length = 164277

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 365    tacacaggggagggagggagggagg 389
              |||||| ||||||||||||||||||
Sbjct: 151462 tacacatgggagggagggagggagg 151486



to top

>emb|AL590144.10| Mouse DNA sequence from clone RP23-79F10 on chromosome 15, complete
              sequence
          Length = 166677

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 164227 caggggagggagggagggagg 164207



to top

>gb|AC124471.4| Mus musculus BAC clone RP24-79D7 from 12, complete sequence
          Length = 179503

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 110968 caggggagggagggagggagg 110988



to top

>gb|AC142262.3| Mus musculus BAC clone RP24-486I4 from 8, complete sequence
          Length = 204183

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 89525 caggggagggagggagggagg 89545



to top

>gb|BC006066.1| Mus musculus mercaptopyruvate sulfurtransferase, mRNA (cDNA clone
            IMAGE:3592658)
          Length = 1275

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 369  caggggagggagggagggagg 389
            |||||||||||||||||||||
Sbjct: 1134 caggggagggagggagggagg 1154



to top

>ref|NM_138670.2| Mus musculus mercaptopyruvate sulfurtransferase (Mpst), mRNA
          Length = 1438

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 369  caggggagggagggagggagg 389
            |||||||||||||||||||||
Sbjct: 1293 caggggagggagggagggagg 1313



to top

>emb|AJ418551.1|SAU418551 Sparus aurata satellite DNA, clone SAgenomic-IMBB09
          Length = 597

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 331 taacttaacacttgttgcatg 351
           |||||||||||||||||||||
Sbjct: 395 taacttaacacttgttgcatg 375



to top

>emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chromosome 4, complete
             sequence
          Length = 194837

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 202   ggctggctgtatttctttctt 222
             |||||||||||||||||||||
Sbjct: 87547 ggctggctgtatttctttctt 87567



to top

>emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chromosome 4, complete
             sequence
          Length = 181004

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 369   caggggagggagggagggagg 389
             |||||||||||||||||||||
Sbjct: 30840 caggggagggagggagggagg 30820



to top

>emb|AL845165.4| Mouse DNA sequence from clone RP23-281N9 on chromosome 2, complete
              sequence
          Length = 112789

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 369    caggggagggagggagggagg 389
              |||||||||||||||||||||
Sbjct: 104654 caggggagggagggagggagg 104674



to top

>gb|AC115795.11| Mus musculus chromosome 5, clone RP23-400O10, complete sequence
          Length = 207103

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 117214 aggggagggagggagggagg 117233



to top

>gb|AC115905.8| Mus musculus chromosome 1, clone RP24-472N17, complete sequence
          Length = 173914

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 117903 aggggagggagggagggagg 117884



to top

>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 176599 aggggagggagggagggagg 176618



to top

>gb|AC126539.9| Mus musculus chromosome 8, clone RP24-112G5, complete sequence
          Length = 158710

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 74356 aggggagggagggagggagg 74375



to top

>gb|AC166253.18| Mus musculus  BAC RP23-231M6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207999

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 186723 aggggagggagggagggagg 186742



to top

>gb|AC147806.5| Mus musculus chromosome 1, clone RP23-6O16, complete sequence
          Length = 229200

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 135478 aggggagggagggagggagg 135497



to top

>gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, complete sequence
          Length = 171669

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    tttgtacatacataataata 41
             ||||||||||||||||||||
Sbjct: 66014 tttgtacatacataataata 66033



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 41159 aggggagggagggagggagg 41178



to top

>gb|AC152953.1| Mus musculus 10 BAC RP23-403E19 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 211343

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 206   ggctgtatttctttcttcttcttc 229
             |||| |||||||||||||||||||
Sbjct: 35518 ggctttatttctttcttcttcttc 35541



to top

>gb|AC124821.5| Mus musculus chromosome 1, clone RP24-211L16, complete sequence
          Length = 185212

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 51728 aggggagggagggagggagg 51747



to top

>gb|AC163280.2| Mus musculus BAC clone RP23-478G5 from chromosome 14, complete sequence
          Length = 202761

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 19837 aggggagggagggagggagg 19856



to top

>gb|AC166491.8| Mus musculus chromosome 15, clone RP24-380A15, complete sequence
          Length = 154673

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 58257 aggggagggagggagggagg 58276



to top

>gb|AC122313.4| Mus musculus BAC clone RP23-300N8 from chromosome 13, complete sequence
          Length = 224940

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 197813 aggggagggagggagggagg 197832



to top

>gb|AC105173.10| Mus musculus chromosome 8, clone RP23-319J15, complete sequence
          Length = 186945

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 174459 aggggagggagggagggagg 174478



to top

>gb|AC116792.17| Mus musculus chromosome 6, clone RP24-304O23, complete sequence
          Length = 155145

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 84433 aggggagggagggagggagg 84414



to top

>gb|AC167012.3| Mus musculus BAC clone RP23-416A5 from chromosome 13, complete sequence
          Length = 193916

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 35788 aggggagggagggagggagg 35807



to top

>gb|AC123609.11| Mus musculus chromosome 3, clone RP23-281B17, complete sequence
          Length = 223516

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 180779 aggggagggagggagggagg 180760



to top

>gb|AC152753.1| Mus musculus chromosome 17 clone RP23-65L9, complete sequence
          Length = 211853

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 188647 aggggagggagggagggagg 188628



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 188598 aggggagggagggagggagg 188579



to top

>gb|AC120878.10| Mus musculus chromosome 1, clone RP24-548K2, complete sequence
          Length = 232085

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 55091 aggggagggagggagggagg 55110



to top

>gb|AC160118.2| Mus musculus BAC clone RP23-440L7 from chromosome 9, complete sequence
          Length = 198672

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 108073 aggggagggagggagggagg 108092



to top

>gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome 6, complete sequence
          Length = 229027

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 43798 aggggagggagggagggagg 43817



to top

>gb|AC165356.5| Mus musculus BAC clone RP23-142E18 from chromosome 7, complete sequence
          Length = 207936

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 127290 aggggagggagggagggagg 127309



to top

>gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome 12, complete sequence
          Length = 199262

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 29547 aggggagggagggagggagg 29566



to top

>gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome 3, complete sequence
          Length = 227070

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 51216 aggggagggagggagggagg 51197



to top

>gb|AC154204.2| Mus musculus BAC clone RP24-393D5 from chromosome 17, complete sequence
          Length = 183408

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 161515 aggggagggagggagggagg 161534



to top

>gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome 13, complete sequence
          Length = 155751

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 179   actgactcactgacttgctggctggctg 206
             ||||||| ||||||| ||||||||||||
Sbjct: 36591 actgactgactgactggctggctggctg 36564



to top

>gb|AC166332.7| Mus musculus chromosome 1, clone RP24-266F18, complete sequence
          Length = 167566

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 366   acacaggggagggagggagggagg 389
             ||||| ||||||||||||||||||
Sbjct: 38254 acacacgggagggagggagggagg 38277



to top

>gb|AC158976.14| Mus musculus chromosome 15, clone RP24-71M3, complete sequence
          Length = 182465

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 29460 aggggagggagggagggagg 29479



to top

>gb|AC163447.5| Mus musculus chromosome 7, clone RP24-314E16, complete sequence
          Length = 135851

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 370  aggggagggagggagggagg 389
            ||||||||||||||||||||
Sbjct: 9340 aggggagggagggagggagg 9359



to top

>gb|AC120865.7| Mus musculus chromosome 5, clone RP23-88L6, complete sequence
          Length = 235287

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 146509 aggggagggagggagggagg 146528



to top

>gb|AC120871.12| Mus musculus chromosome 16, clone RP23-121E8, complete sequence
          Length = 218995

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 10917 aggggagggagggagggagg 10898



to top

>gb|AC102611.10| Mus musculus chromosome 1, clone RP23-416O18, complete sequence
          Length = 210808

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 154892 aggggagggagggagggagg 154911



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 154875 aggggagggagggagggagg 154894



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 154858 aggggagggagggagggagg 154877



to top

>gb|AC104918.13| Mus musculus chromosome 7, clone RP23-335G1, complete sequence
          Length = 204099

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 162313 aggggagggagggagggagg 162294



to top

>gb|AC113325.7| Mus musculus chromosome 1, clone RP23-453H23, complete sequence
          Length = 191225

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 169743 aggggagggagggagggagg 169724



to top

>gb|AC109205.12| Mus musculus chromosome 7, clone RP23-137A4, complete sequence
          Length = 225302

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 103964 aggggagggagggagggagg 103983



to top

>ref|NM_177075.2| Mus musculus RIKEN cDNA C030019I05 gene (C030019I05Rik), mRNA
          Length = 2263

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 370  aggggagggagggagggagg 389
            ||||||||||||||||||||
Sbjct: 1216 aggggagggagggagggagg 1197



to top

>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence
          Length = 384518

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 113949 aggggagggagggagggagg 113930



to top

>gb|AC109184.7| Mus musculus chromosome 8, clone RP24-386O11, complete sequence
          Length = 136831

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 124329 aggggagggagggagggagg 124310



to top

>gb|AC137121.9| Mus musculus chromosome 5, clone RP23-286M22, complete sequence
          Length = 181548

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 114555 aggggagggagggagggagg 114574



to top

>gb|AC115855.9| Mus musculus chromosome 3, clone RP24-277E17, complete sequence
          Length = 182349

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 142684 aggggagggagggagggagg 142703



to top

>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence
          Length = 191054

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 169248 aggggagggagggagggagg 169267



to top

>gb|AC169697.1| Rhesus Macaque  BAC CH250-38L23 (Children's Hospital Oakland
           Research Institute Rhesus macaque Adult Male BAC
           Library) complete sequence
          Length = 154876

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 370 aggggagggagggagggagg 389
           ||||||||||||||||||||
Sbjct: 342 aggggagggagggagggagg 323



to top

>gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, complete sequence
          Length = 158006

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 12905 aggggagggagggagggagg 12924



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 147212 aggggagggagggagggagg 147193



to top

>gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases 501860 to 700960 (section 3 of 3)
              of the complete sequence
          Length = 199101

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 150153 aggggagggagggagggagg 150172



to top

>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence
          Length = 1608198

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    atttctttcttcttcttcgt 231
              ||||||||||||||||||||
Sbjct: 275051 atttctttcttcttcttcgt 275070



to top

>gb|AC159441.1| Trypanosoma brucei chromosome 5 clone RPCI93-30F7, complete sequence
          Length = 101712

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   atttctttcttcttcttcgt 231
             ||||||||||||||||||||
Sbjct: 15092 atttctttcttcttcttcgt 15073



to top

>gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8, complete sequence
          Length = 140539

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 212    atttctttcttcttcttcgt 231
              ||||||||||||||||||||
Sbjct: 118475 atttctttcttcttcttcgt 118456



to top

>gb|AC102517.7| Mus musculus chromosome 5, clone RP24-491H24, complete sequence
          Length = 186022

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 10696 aggggagggagggagggagg 10677



to top

>gb|AC102380.6| Mus musculus chromosome 3, clone RP24-179F24, complete sequence
          Length = 169209

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 49589 aggggagggagggagggagg 49570



to top

>gb|AC168268.2| Mus musculus BAC clone RP23-339K12 from chromosome 17, complete
            sequence
          Length = 184085

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 370  aggggagggagggagggagg 389
            ||||||||||||||||||||
Sbjct: 3705 aggggagggagggagggagg 3724



to top

>gb|AC167421.2| Mus musculus BAC clone RP23-143K19 from chromosome 3, complete sequence
          Length = 194311

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 47032 aggggagggagggagggagg 47013



to top

>gb|AC119266.14| Mus musculus chromosome 13, clone RP24-321G8, complete sequence
          Length = 174035

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 114066 aggggagggagggagggagg 114085



to top

>gb|AC116525.24| Mus musculus chromosome 15, clone RP24-352I18, complete sequence
          Length = 149726

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 10736 aggggagggagggagggagg 10717



to top

>gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, complete sequence
          Length = 155647

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 139819 aggggagggagggagggagg 139838



to top

>gb|AC165091.3| Mus musculus BAC clone RP23-25M19 from chromosome 17, complete sequence
          Length = 198085

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 82997 aggggagggagggagggagg 83016



to top

>gb|AC151843.3| Mus musculus BAC clone RP23-88K14 from chromosome 10, complete sequence
          Length = 268516

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 31568 aggggagggagggagggagg 31587



to top

>gb|AC154523.2| Mus musculus BAC clone RP24-65H12 from chromosome 13, complete sequence
          Length = 196410

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 103467 aggggagggagggagggagg 103486



to top

>gb|AC164646.3| Mus musculus BAC clone RP24-262I1 from chromosome 3, complete sequence
          Length = 175326

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 30605 aggggagggagggagggagg 30624



to top

>gb|AC151715.3| Mus musculus BAC clone RP23-396L12 from chromosome 7, complete sequence
          Length = 204221

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 22624 aggggagggagggagggagg 22643



to top

>gb|AC165254.2| Mus musculus BAC clone RP23-285H4 from chromosome 13, complete sequence
          Length = 229672

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 160271 aggggagggagggagggagg 160252



to top

>gb|AC110036.8| Mus musculus chromosome 7, clone RP23-254F9, complete sequence
          Length = 185681

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 41456 aggggagggagggagggagg 41437



to top

>gb|AC109186.7| Mus musculus chromosome 5, clone RP24-351E22, complete sequence
          Length = 174202

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 370  aggggagggagggagggagg 389
            ||||||||||||||||||||
Sbjct: 7807 aggggagggagggagggagg 7826



to top

>gb|AC120366.9| Mus musculus chromosome 1, clone RP24-294P1, complete sequence
          Length = 156784

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 12443 aggggagggagggagggagg 12462



to top

>gb|AC139225.10| Mus musculus chromosome 9, clone RP24-361G12, complete sequence
          Length = 196867

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 41056 aggggagggagggagggagg 41037



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 40994 aggggagggagggagggagg 40975



to top

>gb|AC131980.9| Mus musculus chromosome 1, clone RP24-170O7, complete sequence
          Length = 200100

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 140074 aggggagggagggagggagg 140055



to top

>gb|AC119908.16| Mus musculus chromosome 7, clone RP24-240G4, complete sequence
          Length = 190369

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 142331 aggggagggagggagggagg 142350



to top

>gb|AC123659.11| Mus musculus chromosome 17, clone RP23-192P18, complete sequence
          Length = 207169

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 41417 aggggagggagggagggagg 41398



to top

>gb|AC119190.7| Mus musculus chromosome 8, clone RP24-178B9, complete sequence
          Length = 139843

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 40993 aggggagggagggagggagg 40974



to top

>gb|AC118194.8| Mus musculus chromosome 3, clone RP23-464I9, complete sequence
          Length = 180205

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 119828 aggggagggagggagggagg 119847



to top

>gb|AC137124.17| Mus musculus chromosome 3, clone RP24-229P11, complete sequence
          Length = 172081

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 18011 aggggagggagggagggagg 18030



to top

>gb|AC115933.7| Mus musculus chromosome 3, clone RP24-539I8, complete sequence
          Length = 187920

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 21336 aggggagggagggagggagg 21355



to top

>gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete sequence
          Length = 188549

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 187   actgacttgctggctggctggctg 210
             ||||||| ||||||||||||||||
Sbjct: 87679 actgactggctggctggctggctg 87656



to top

>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence
          Length = 185670

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 179  actgactcactgacttgctggctg 202
            ||||||| ||||||||||||||||
Sbjct: 1216 actgactgactgacttgctggctg 1239



to top

>gb|AC069469.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-75J13, complete
             sequence
          Length = 172786

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 38952 aggggagggagggagggagg 38933



to top

>gb|AC138376.11| Mus musculus chromosome 7, clone RP23-53O7, complete sequence
          Length = 247484

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 137912 aggggagggagggagggagg 137931



to top

>gb|AC113283.13| Mus musculus chromosome 3, clone RP23-397I12, complete sequence
          Length = 189865

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 133769 aggggagggagggagggagg 133788



to top

>gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 231716

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   acaggggagggagggaggga 387
             ||||||||||||||||||||
Sbjct: 75522 acaggggagggagggaggga 75541



to top

>gb|AC112330.5| Rattus norvegicus 15 BAC CH230-185E8 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 158526

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 47011 aggggagggagggagggagg 46992



to top

>gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 133054

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 366   acacaggggagggagggagggagg 389
             ||||| ||||||||||||||||||
Sbjct: 73065 acacacgggagggagggagggagg 73042



to top

>gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, complete sequence
          Length = 215113

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 198    ggctggctggctgtatttct 217
              ||||||||||||||||||||
Sbjct: 183391 ggctggctggctgtatttct 183372



to top

>gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21-667A15, RP21-395M8
              complete sequence
          Length = 350000

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 190021 aggggagggagggagggagg 190040



to top

>gb|AC008346.6| Drosophila melanogaster clone BACR45K04, complete sequence
          Length = 181142

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 179   actgactcactgacttgctggctg 202
             ||||||| ||||||||||||||||
Sbjct: 94605 actgactgactgacttgctggctg 94582



to top

>gb|AC138676.9| Mus musculus chromosome 3, clone RP23-381I16, complete sequence
          Length = 204781

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 62216 aggggagggagggagggagg 62235



to top

>gb|AC113548.22| Mus musculus chromosome 9, clone RP23-268F15, complete sequence
          Length = 195273

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 39230 aggggagggagggagggagg 39249



to top

>gb|AC129552.20| Mus musculus chromosome 5, clone RP24-122N24, complete sequence
          Length = 153520

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 107180 aggggagggagggagggagg 107161



to top

>gb|AC117826.10| Mus musculus chromosome 1, clone RP24-81K19, complete sequence
          Length = 227953

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    aggggagggagggagggagg 389
              ||||||||||||||||||||
Sbjct: 227513 aggggagggagggagggagg 227532



to top

>gb|AC114678.20| Mus musculus chromosome 10, clone RP24-213L12, complete sequence
          Length = 180079

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   aggggagggagggagggagg 389
             ||||||||||||||||||||
Sbjct: 72892 aggggagggagggagggagg 72911


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,229,244
Number of Sequences: 3902068
Number of extensions: 7229244
Number of successful extensions: 513230
Number of sequences better than 10.0: 1018
Number of HSP's better than 10.0 without gapping: 1011
Number of HSP's successfully gapped in prelim test: 7
Number of HSP's that attempted gapping in prelim test: 491613
Number of HSP's gapped (non-prelim): 19548
length of query: 389
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 367
effective length of database: 17,147,199,772
effective search space: 6293022316324
effective search space used: 6293022316324
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top