ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl40e11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016619.1| Zea mays clone Contig452 mRNA sequence 50 0.003
2gb|AY104402.1| Zea mays PCO137047 mRNA sequence 50 0.003
3dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 42 0.71
4gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 42 0.71
5gb|AC138174.9| Mus musculus, clone RP24-198I22, complete sequence 40 2.8
6gb|AY527062.1| Mytilus edulis 18S ribosomal RNA gene, partial se... 40 2.8
7gb|AC134763.4| Rattus norvegicus BAC CH230-221M14 (Children's H... 40 2.8
8emb|BX005315.7| Zebrafish DNA sequence from clone DKEY-79E6, com... 40 2.8
9dbj|AB201231.1| Musculista senhousia gene for 18S ribosomal RNA,... 40 2.8
10gb|AF124207.1|AF124207 Musculus senhousei 18S ribosomal RNA gene... 40 2.8
11gb|AF124206.1|AF124206 Musculus discors 18S ribosomal RNA gene, ... 40 2.8
12gb|L33448.1|MSLSRRNAA Mytilus edulis 18S small subunit ribosomal... 40 2.8
13gb|L33449.1|MSLSRRNAB Mytilus californianus 18S small subunit ri... 40 2.8
14gb|L33451.1|MSLSRRNAC Mytilus galloprovincialis isolate Morgat, ... 40 2.8
15gb|L33453.1|MSLSRRNAE Mytilus trossulus strain Pacific strain 1 ... 40 2.8
16gb|L33454.1|MSLSRRNAF Mytilus trossulus strain Pacific strain 2 ... 40 2.8
17gb|L33455.1|MSLSRRNAG Mytilus trossulus strain Pacific strain 3 ... 40 2.8
18dbj|AP001561.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 2.8
19gb|DQ310715.1| Mytella strigata 18S ribosomal RNA gene, partial ... 40 2.8
20emb|X90960.1|AN18SRRNA A.noae 18S ribosomal RNA gene 40 2.8
21emb|X91403.1|AGEL18S A.gelatinosum 18S ribosomal RNA gene 40 2.8
22gb|L24490.1|MSLMRNAB Mytilus trossulus 18S ribosomal RNA (18S rRNA) 40 2.8
23gb|L24489.1|MSLMRNAA Mytilus edulis 18S ribosomal RNA (18SrRNA) 40 2.8

>gb|BT016619.1| Zea mays clone Contig452 mRNA sequence
          Length = 1911

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 145  tgcttgtgagcgagctccttgagaacatttccgaggttggactcgcccttggtgctcttg 204
            ||||||| ||| |||| |||||||||||| |||||||  | |||| ||||| || |||||
Sbjct: 1769 tgcttgtaagccagcttcttgagaacattgccgaggtcagcctcggccttgatgttcttg 1710

                 
Query: 205  accca 209
            |||||
Sbjct: 1709 accca 1705



to top

>gb|AY104402.1| Zea mays PCO137047 mRNA sequence
          Length = 2125

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 145  tgcttgtgagcgagctccttgagaacatttccgaggttggactcgcccttggtgctcttg 204
            ||||||| ||| |||| |||||||||||| |||||||  | |||| ||||| || |||||
Sbjct: 1807 tgcttgtaagccagcttcttgagaacattgccgaggtcagcctcggccttgatgttcttg 1748

                 
Query: 205  accca 209
            |||||
Sbjct: 1747 accca 1743



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 68      gctcagtcaaaccagcaccac 88
               |||||||||||||||||||||
Sbjct: 1031023 gctcagtcaaaccagcaccac 1031043



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 42.1 bits (21), Expect = 0.71
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 68     gctcagtcaaaccagcaccac 88
              |||||||||||||||||||||
Sbjct: 589854 gctcagtcaaaccagcaccac 589834



to top

>gb|AC138174.9| Mus musculus, clone RP24-198I22, complete sequence
          Length = 177516

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    tttattattaccatattatt 43
             ||||||||||||||||||||
Sbjct: 88583 tttattattaccatattatt 88564



to top

>gb|AY527062.1| Mytilus edulis 18S ribosomal RNA gene, partial sequence
          Length = 1823

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 716 tcgcccttggtgctcttgac 735



to top

>gb|AC134763.4| Rattus norvegicus  BAC CH230-221M14 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 222524

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 82     gcaccacagggaagagggctgaat 105
              ||||||||||| ||||||||||||
Sbjct: 120255 gcaccacagggcagagggctgaat 120232



to top

>emb|BX005315.7| Zebrafish DNA sequence from clone DKEY-79E6, complete sequence
          Length = 130903

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 24   tttattattaccatattatt 43
            ||||||||||||||||||||
Sbjct: 8611 tttattattaccatattatt 8630



to top

>dbj|AB201231.1| Musculista senhousia gene for 18S ribosomal RNA, partial sequence
          Length = 1740

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 670 tcgcccttggtgctcttgac 689



to top

>gb|AF124207.1|AF124207 Musculus senhousei 18S ribosomal RNA gene, partial sequence
          Length = 1778

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 687 tcgcccttggtgctcttgac 706



to top

>gb|AF124206.1|AF124206 Musculus discors 18S ribosomal RNA gene, partial sequence
          Length = 1782

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 696 tcgcccttggtgctcttgac 715



to top

>gb|L33448.1|MSLSRRNAA Mytilus edulis 18S small subunit ribosomal RNA gene, complete
           sequence
          Length = 1827

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 717 tcgcccttggtgctcttgac 736



to top

>gb|L33449.1|MSLSRRNAB Mytilus californianus 18S small subunit ribosomal RNA gene,
           complete sequence
          Length = 1825

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 715 tcgcccttggtgctcttgac 734



to top

>gb|L33451.1|MSLSRRNAC Mytilus galloprovincialis isolate Morgat, Bay of Douarnenez, West
           Brittany, France 18S small subunit ribosomal RNA gene,
           complete sequence
          Length = 1826

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 716 tcgcccttggtgctcttgac 735



to top

>gb|L33453.1|MSLSRRNAE Mytilus trossulus strain Pacific strain 1 18S small subunit
           ribosomal RNA gene, complete sequence
          Length = 1827

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 717 tcgcccttggtgctcttgac 736



to top

>gb|L33454.1|MSLSRRNAF Mytilus trossulus strain Pacific strain 2 18S small subunit
           ribosomal RNA gene, complete sequence
          Length = 1827

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 717 tcgcccttggtgctcttgac 736



to top

>gb|L33455.1|MSLSRRNAG Mytilus trossulus strain Pacific strain 3 18S small subunit
           ribosomal RNA gene, complete sequence
          Length = 1826

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 716 tcgcccttggtgctcttgac 735



to top

>dbj|AP001561.4| Homo sapiens genomic DNA, chromosome 11q clone:RP11-732G1, complete
              sequences
          Length = 195800

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 78     accagcaccacagggaagag 97
              ||||||||||||||||||||
Sbjct: 165694 accagcaccacagggaagag 165675



to top

>gb|DQ310715.1| Mytella strigata 18S ribosomal RNA gene, partial sequence
          Length = 415

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 125 tcgcccttggtgctcttgac 144



to top

>emb|X90960.1|AN18SRRNA A.noae 18S ribosomal RNA gene
          Length = 1782

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 712 tcgcccttggtgctcttgac 731



to top

>emb|X91403.1|AGEL18S A.gelatinosum 18S ribosomal RNA gene
          Length = 1813

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 714 tcgcccttggtgctcttgac 733



to top

>gb|L24490.1|MSLMRNAB Mytilus trossulus 18S ribosomal RNA (18S rRNA)
          Length = 1826

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 716 tcgcccttggtgctcttgac 735



to top

>gb|L24489.1|MSLMRNAA Mytilus edulis 18S ribosomal RNA (18SrRNA)
          Length = 1826

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 tcgcccttggtgctcttgac 206
           ||||||||||||||||||||
Sbjct: 717 tcgcccttggtgctcttgac 736


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,535,616
Number of Sequences: 3902068
Number of extensions: 1535616
Number of successful extensions: 105507
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 105442
Number of HSP's gapped (non-prelim): 65
length of query: 220
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 198
effective length of database: 17,147,199,772
effective search space: 3395145554856
effective search space used: 3395145554856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top