ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl40d05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_641034.1| Dictyostelium discoideum hypothetical protein (... 44 0.38
2dbj|AK128329.1| Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394 44 0.38
3gb|AC154501.2| Mus musculus BAC clone RP24-87F14 from chromosome... 44 0.38
4emb|CR407557.10| Zebrafish DNA sequence from clone DKEYP-66B8 in... 44 0.38
5emb|AL121673.41|HSA305P22 Human DNA sequence from clone RP11-305... 44 0.38
6emb|BX511250.8| Zebrafish DNA sequence from clone CH211-57K11 in... 42 1.5
7emb|BX067989.1|CNS09OMH Single read from an extremity of a full-... 40 5.9
8emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 40 5.9
9dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 40 5.9
10gb|AC093680.2| Homo sapiens BAC clone RP11-656C2 from 4, complet... 40 5.9
11gb|DQ355805.1| Trichoplax adhaerens ANTP homeobox protein (Hmx) ... 40 5.9
12gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 40 5.9
13gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 40 5.9
14gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 40 5.9
15ref|NM_068167.2| Caenorhabditis elegans R08C7.10c (R08C7.10) mRN... 40 5.9
16ref|NM_068165.2| Caenorhabditis elegans R08C7.10b (R08C7.10) mRN... 40 5.9
17ref|NM_068166.2| Caenorhabditis elegans R08C7.10a (R08C7.10) mRN... 40 5.9
18gb|AF296838.1|T29J13 Arabidopsis thaliana BAC T29J13 40 5.9
19dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 40 5.9
20dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 40 5.9
21gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence 40 5.9
22dbj|AP002453.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.9
23dbj|AP003384.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.9
24gb|AC153498.17| Mus musculus 10 BAC RP23-353P23 (Roswell Park Ca... 40 5.9
25emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 40 5.9
26dbj|AP002076.3| Homo sapiens genomic DNA, chromosome 4q22-q24, c... 40 5.9

>ref|XM_641034.1| Dictyostelium discoideum hypothetical protein (DDB0190412), partial
            mRNA
          Length = 4014

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 12   taaaagttgatgttcagttggaaaaa 37
            |||||||||||||| |||||||||||
Sbjct: 1005 taaaagttgatgttgagttggaaaaa 980



to top

>dbj|AK128329.1| Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394
          Length = 3366

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 85   ccaggagaaaacagccctaaca 106
            ||||||||||||||||||||||
Sbjct: 2813 ccaggagaaaacagccctaaca 2834



to top

>gb|AC154501.2| Mus musculus BAC clone RP24-87F14 from chromosome 14, complete sequence
          Length = 215658

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 108    ctgagaaataaacacatcatct 129
              ||||||||||||||||||||||
Sbjct: 138998 ctgagaaataaacacatcatct 139019



to top

>emb|CR407557.10| Zebrafish DNA sequence from clone DKEYP-66B8 in linkage group 6,
             complete sequence
          Length = 119597

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 39    atgagtttggcaagtttaaaac 60
             ||||||||||||||||||||||
Sbjct: 53410 atgagtttggcaagtttaaaac 53431



to top

>emb|AL121673.41|HSA305P22 Human DNA sequence from clone RP11-305P22 on chromosome 20 Contains the
              3' end of the C20orf11 gene, the C20orf59 gene, the BHLHB4
              gene for basic helix-loop-helix domain containing (class B)
              4, the C20orf51 gene, a novel gene and seven CpG islands,
              complete sequence
          Length = 151163

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 85     ccaggagaaaacagccctaaca 106
              ||||||||||||||||||||||
Sbjct: 145093 ccaggagaaaacagccctaaca 145114



to top

>emb|BX511250.8| Zebrafish DNA sequence from clone CH211-57K11 in linkage group 16,
             complete sequence
          Length = 189081

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 39    atgagtttggcaagtttaaaacatt 63
             ||||||||| |||||||||||||||
Sbjct: 84685 atgagtttgacaagtttaaaacatt 84709



to top

>emb|BX067989.1|CNS09OMH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 385 cagcaatggccccgacggaa 404
           ||||||||||||||||||||
Sbjct: 85  cagcaatggccccgacggaa 104



to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 633694 actaaaagttgatgttcagt 633713



to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 668801 actaaaagttgatgttcagt 668820



to top

>gb|AC093680.2| Homo sapiens BAC clone RP11-656C2 from 4, complete sequence
          Length = 150399

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    acattcacatttcttttcaa 186
              ||||||||||||||||||||
Sbjct: 116164 acattcacatttcttttcaa 116145



to top

>gb|DQ355805.1| Trichoplax adhaerens ANTP homeobox protein (Hmx) gene, complete cds
          Length = 11728

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 170  ttcacatttcttttcaacac 189
            ||||||||||||||||||||
Sbjct: 1617 ttcacatttcttttcaacac 1598



to top

>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 671962 actaaaagttgatgttcagt 671981



to top

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 583287 actaaaagttgatgttcagt 583306



to top

>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 650493 actaaaagttgatgttcagt 650512



to top

>ref|NM_068167.2| Caenorhabditis elegans R08C7.10c (R08C7.10) mRNA, complete cds
          Length = 2219

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccgaattagcatccgacga 320
           ||||||||||||||||||||
Sbjct: 124 tccgaattagcatccgacga 105



to top

>ref|NM_068165.2| Caenorhabditis elegans R08C7.10b (R08C7.10) mRNA, complete cds
          Length = 2328

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccgaattagcatccgacga 320
           ||||||||||||||||||||
Sbjct: 104 tccgaattagcatccgacga 85



to top

>ref|NM_068166.2| Caenorhabditis elegans R08C7.10a (R08C7.10) mRNA, complete cds
          Length = 2463

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 tccgaattagcatccgacga 320
           ||||||||||||||||||||
Sbjct: 23  tccgaattagcatccgacga 4



to top

>gb|AF296838.1|T29J13 Arabidopsis thaliana BAC T29J13
          Length = 100592

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   ctgagaaataaacacatcat 127
             ||||||||||||||||||||
Sbjct: 79474 ctgagaaataaacacatcat 79455



to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 635003 actaaaagttgatgttcagt 635022



to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 644554 actaaaagttgatgttcagt 644573



to top

>gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence
          Length = 39012

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 301   tccgaattagcatccgacga 320
             ||||||||||||||||||||
Sbjct: 24656 tccgaattagcatccgacga 24675



to top

>dbj|AP002453.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-801G16, complete
              sequence
          Length = 211345

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    ttcacatttcttttcaacac 189
              ||||||||||||||||||||
Sbjct: 207087 ttcacatttcttttcaacac 207106



to top

>dbj|AP003384.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-35N19, complete
             sequence
          Length = 156712

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 170   ttcacatttcttttcaacac 189
             ||||||||||||||||||||
Sbjct: 75931 ttcacatttcttttcaacac 75950



to top

>gb|AC153498.17| Mus musculus 10 BAC RP23-353P23 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 192394

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    ttctctcgtctaaaatacca 81
             ||||||||||||||||||||
Sbjct: 22177 ttctctcgtctaaaatacca 22196



to top

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     actaaaagttgatgttcagt 29
              ||||||||||||||||||||
Sbjct: 608561 actaaaagttgatgttcagt 608580



to top

>dbj|AP002076.3| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2230N19, complete
              sequence
          Length = 117217

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    acattcacatttcttttcaa 186
              ||||||||||||||||||||
Sbjct: 105282 acattcacatttcttttcaa 105263


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,363,452
Number of Sequences: 3902068
Number of extensions: 4363452
Number of successful extensions: 80234
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80094
Number of HSP's gapped (non-prelim): 140
length of query: 438
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 416
effective length of database: 17,147,199,772
effective search space: 7133235105152
effective search space used: 7133235105152
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top