ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl40c01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC137065.26| Medicago truncatula clone mth2-29h7, complete se... 42 0.60
2gb|AC154554.2| Mus musculus BAC clone RP23-416P6 from chromosome... 40 2.4
3gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 40 2.4
4emb|AL671917.8| Mouse DNA sequence from clone RP23-217I18 on chr... 40 2.4
5gb|AY510328.1| Rattus norvegicus vomeronasal V1r-type receptor V... 38 9.3
6gb|AC161435.7| Mus musculus chromosome 8, clone RP23-78L21, comp... 38 9.3
7gb|AC167019.4| Mus musculus BAC clone RP23-262K24 from chromosom... 38 9.3
8gb|AC115865.9| Mus musculus chromosome 3, clone RP24-314I8, comp... 38 9.3
9gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 38 9.3
10gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 38 9.3
11gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 38 9.3
12emb|CR940309.6| M.truncatula DNA sequence from clone MTH2-10C20 ... 38 9.3
13gb|CP000001.1| Bacillus cereus E33L, complete genome 38 9.3
14ref|NM_001008940.1| Rattus norvegicus vomeronasal 1 receptor, g1... 38 9.3
15gb|AC124958.13| Medicago truncatula clone mth2-18i11, complete s... 38 9.3
16emb|AL358176.22| Human DNA sequence from clone RP11-467I20 on ch... 38 9.3
17emb|AL023656.8|HS39B17 Human DNA sequence from clone RP1-39B17 o... 38 9.3
18gb|AC144474.22| Medicago truncatula clone mth2-15l5, complete se... 38 9.3
19dbj|AB223384.1| Aspergillus oryzae cDNA, contig sequence: AoEST0216 38 9.3
20dbj|AB223275.1| Aspergillus oryzae cDNA, contig sequence: AoEST0106 38 9.3
21dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113 38 9.3
22gb|AC079232.7| Homo sapiens BAC clone RP11-360H22 from 4, comple... 38 9.3
23gb|AC011712.6|AC011712 Homo sapiens chromosome 18, clone RP11-18... 38 9.3
24gb|AC051663.9|AC051663 Homo sapiens BAC clone RP11-475P15 from Y... 38 9.3
25gb|AC006386.4|AC006386 Homo sapiens clone RP11-566H16, complete ... 38 9.3
26gb|AC016698.3|AC016698 Homo sapiens clone RP11-160O2, complete s... 38 9.3
27gb|AC097462.2| Homo sapiens BAC clone RP11-18O11 from 4, complet... 38 9.3
28gb|AC016911.6|AC016911 Homo sapiens BAC clone RP11-473E1 from Y,... 38 9.3
29ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 38 9.3
30gb|AF130426.1|AF130426 Lycopersicon esculentum cryptochrome 2 ge... 38 9.3
31emb|AL136296.3|CNS01DW0 Human chromosome 14 DNA sequence BAC R-5... 38 9.3
32emb|AL160471.5|CNS01RH4 Human chromosome 14 DNA sequence BAC R-3... 38 9.3
33emb|AL352982.3|CNS05TBY Human chromosome 14 DNA sequence Partial... 38 9.3
34gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 38 9.3
35gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 38 9.3
36emb|AL513143.3|CNS07EFO Human chromosome 14 DNA sequence BAC R-6... 38 9.3
37emb|AL163151.1|CNS01RIC Human chromosome 14 DNA sequence BAC R-1... 38 9.3
38emb|AL157690.7|CNS01RG2 Human chromosome 14 DNA sequence BAC R-5... 38 9.3

>gb|AC137065.26| Medicago truncatula clone mth2-29h7, complete sequence
          Length = 105004

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 36     aaatattagtcaacaatggtacaaa 60
              |||||||||||||||||| ||||||
Sbjct: 101295 aaatattagtcaacaatgttacaaa 101319



to top

>gb|AC154554.2| Mus musculus BAC clone RP23-416P6 from chromosome 13, complete sequence
          Length = 204294

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     tacaaaatattagtcaacaa 51
              ||||||||||||||||||||
Sbjct: 131842 tacaaaatattagtcaacaa 131823



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 33      acaaaatattagtcaacaat 52
               ||||||||||||||||||||
Sbjct: 2555987 acaaaatattagtcaacaat 2555968



to top

>emb|AL671917.8| Mouse DNA sequence from clone RP23-217I18 on chromosome 3, complete
             sequence
          Length = 172826

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    aaatattagtcaacaatggt 55
             ||||||||||||||||||||
Sbjct: 59691 aaatattagtcaacaatggt 59710



to top

>gb|AY510328.1| Rattus norvegicus vomeronasal V1r-type receptor V1rg10 mRNA,
           complete cds
          Length = 948

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 131 actcaacctgtaagttcaatttt 153
           |||||||||||||||| ||||||
Sbjct: 525 actcaacctgtaagttgaatttt 503



to top

>gb|AC161435.7| Mus musculus chromosome 8, clone RP23-78L21, complete sequence
          Length = 219937

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 44     gtcaacaatggtacaaaatatta 66
              |||||||||||| ||||||||||
Sbjct: 202571 gtcaacaatggtccaaaatatta 202549



to top

>gb|AC167019.4| Mus musculus BAC clone RP23-262K24 from chromosome 15, complete sequence
          Length = 207785

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 19     tgtactcaattggtacaaa 37
              |||||||||||||||||||
Sbjct: 118988 tgtactcaattggtacaaa 119006



to top

>gb|AC115865.9| Mus musculus chromosome 3, clone RP24-314I8, complete sequence
          Length = 200362

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 33     acaaaatattagtcaacaa 51
              |||||||||||||||||||
Sbjct: 124576 acaaaatattagtcaacaa 124558



to top

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 115     tttctaatactgacgtact 133
               |||||||||||||||||||
Sbjct: 1796246 tttctaatactgacgtact 1796228



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 115     tttctaatactgacgtact 133
               |||||||||||||||||||
Sbjct: 1759355 tttctaatactgacgtact 1759337



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 115     tttctaatactgacgtact 133
               |||||||||||||||||||
Sbjct: 1759300 tttctaatactgacgtact 1759282



to top

>emb|CR940309.6| M.truncatula DNA sequence from clone MTH2-10C20 on chromosome 3,
             complete sequence
          Length = 114380

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 25    caattggtacaaaatattagtca 47
             ||||||||| |||||||||||||
Sbjct: 69547 caattggtataaaatattagtca 69525



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 115     tttctaatactgacgtact 133
               |||||||||||||||||||
Sbjct: 1783843 tttctaatactgacgtact 1783825



to top

>ref|NM_001008940.1| Rattus norvegicus vomeronasal 1 receptor, g10 (V1rg10), mRNA
          Length = 948

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 131 actcaacctgtaagttcaatttt 153
           |||||||||||||||| ||||||
Sbjct: 525 actcaacctgtaagttgaatttt 503



to top

>gb|AC124958.13| Medicago truncatula clone mth2-18i11, complete sequence
          Length = 120562

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 41     ttagtcaacaatggtacaa 59
              |||||||||||||||||||
Sbjct: 116868 ttagtcaacaatggtacaa 116886



to top

>emb|AL358176.22| Human DNA sequence from clone RP11-467I20 on chromosome 1 Contains the
              gene for protein related to DAN and cerberus (FLJ21195),
              two novel genes, a pseudogene similar to part of cytochrome
              c oxidase I (MTCOI1), a ribosomal protein S11 (RPS11)
              pseudogene, a ferredoxin pseudogene and a CpG island,
              complete sequence
          Length = 184311

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 92     ttacattgggaagtaacag 110
              |||||||||||||||||||
Sbjct: 172364 ttacattgggaagtaacag 172382



to top

>emb|AL023656.8|HS39B17 Human DNA sequence from clone RP1-39B17 on chromosome 6q16 Contains the
             3' end of the gene for a novel protein (KIAA1900) and the
             3' end of the gene for a novel protein, complete sequence
          Length = 112361

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 67    actgttagcttcgtcatct 85
             |||||||||||||||||||
Sbjct: 96296 actgttagcttcgtcatct 96278



to top

>gb|AC144474.22| Medicago truncatula clone mth2-15l5, complete sequence
          Length = 142202

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 41   ttagtcaacaatggtacaa 59
            |||||||||||||||||||
Sbjct: 3694 ttagtcaacaatggtacaa 3676



to top

>dbj|AB223384.1| Aspergillus oryzae cDNA, contig sequence: AoEST0216
          Length = 722

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  attggtacaaaatattagt 45
           |||||||||||||||||||
Sbjct: 560 attggtacaaaatattagt 542



to top

>dbj|AB223275.1| Aspergillus oryzae cDNA, contig sequence: AoEST0106
          Length = 722

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 27  attggtacaaaatattagt 45
           |||||||||||||||||||
Sbjct: 662 attggtacaaaatattagt 644



to top

>dbj|AP007166.1| Aspergillus oryzae RIB40 genomic DNA, SC113
          Length = 1841713

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 27     attggtacaaaatattagt 45
              |||||||||||||||||||
Sbjct: 517570 attggtacaaaatattagt 517552



to top

>gb|AC079232.7| Homo sapiens BAC clone RP11-360H22 from 4, complete sequence
          Length = 169281

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 84    ctgcaaaattacattggga 102
             |||||||||||||||||||
Sbjct: 85722 ctgcaaaattacattggga 85704



to top

>gb|AC011712.6|AC011712 Homo sapiens chromosome 18, clone RP11-188I24, complete sequence
          Length = 145165

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 30    ggtacaaaatattagtcaacaat 52
             |||| ||||||||||||||||||
Sbjct: 25854 ggtagaaaatattagtcaacaat 25876



to top

>gb|AC051663.9|AC051663 Homo sapiens BAC clone RP11-475P15 from Y, complete sequence
          Length = 94414

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    aaaatattaactgttagct 76
             |||||||||||||||||||
Sbjct: 82123 aaaatattaactgttagct 82105



to top

>gb|AC006386.4|AC006386 Homo sapiens clone RP11-566H16, complete sequence
          Length = 164229

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 58    aaaatattaactgttagct 76
             |||||||||||||||||||
Sbjct: 29664 aaaatattaactgttagct 29682



to top

>gb|AC016698.3|AC016698 Homo sapiens clone RP11-160O2, complete sequence
          Length = 154286

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    aaaatattaactgttagct 76
             |||||||||||||||||||
Sbjct: 78078 aaaatattaactgttagct 78060



to top

>gb|AC097462.2| Homo sapiens BAC clone RP11-18O11 from 4, complete sequence
          Length = 180973

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 75     cttcgtcatctgcaaaatt 93
              |||||||||||||||||||
Sbjct: 172572 cttcgtcatctgcaaaatt 172554



to top

>gb|AC016911.6|AC016911 Homo sapiens BAC clone RP11-473E1 from Y, complete sequence
          Length = 30824

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 58   aaaatattaactgttagct 76
            |||||||||||||||||||
Sbjct: 6210 aaaatattaactgttagct 6192



to top

>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 58      aaaatattaactgttagct 76
               |||||||||||||||||||
Sbjct: 3387986 aaaatattaactgttagct 3388004



 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 58      aaaatattaactgttagct 76
               |||||||||||||||||||
Sbjct: 2660350 aaaatattaactgttagct 2660332



 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 58      aaaatattaactgttagct 76
               |||||||||||||||||||
Sbjct: 1026602 aaaatattaactgttagct 1026584



to top

>gb|AF130426.1|AF130426 Lycopersicon esculentum cryptochrome 2 gene, complete cds
          Length = 4386

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 50   aatggtacaaaatattaac 68
            |||||||||||||||||||
Sbjct: 3982 aatggtacaaaatattaac 4000



to top

>emb|AL136296.3|CNS01DW0 Human chromosome 14 DNA sequence BAC R-588D7 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192404

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 71     ttagcttcgtcatctgcaaaatt 93
              |||||||| ||||||||||||||
Sbjct: 191125 ttagcttcctcatctgcaaaatt 191103



to top

>emb|AL160471.5|CNS01RH4 Human chromosome 14 DNA sequence BAC R-304L20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 193559

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    tggtacaaaatattagtca 47
             |||||||||||||||||||
Sbjct: 29899 tggtacaaaatattagtca 29917



to top

>emb|AL352982.3|CNS05TBY Human chromosome 14 DNA sequence Partial sequence from BAC R-661F4 of
              library RPCI-11 from chromosome 14 of Homo sapiens (Human),
              complete sequence
          Length = 157058

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     tggtacaaaatattagtca 47
              |||||||||||||||||||
Sbjct: 106324 tggtacaaaatattagtca 106306



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 115     tttctaatactgacgtact 133
               |||||||||||||||||||
Sbjct: 1759232 tttctaatactgacgtact 1759214



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 115     tttctaatactgacgtact 133
               |||||||||||||||||||
Sbjct: 1890257 tttctaatactgacgtact 1890239



to top

>emb|AL513143.3|CNS07EFO Human chromosome 14 DNA sequence BAC R-611H21 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 155584

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 45    tcaacaatggtacaaaatattaa 67
             ||||||||||| |||||||||||
Sbjct: 12627 tcaacaatggtccaaaatattaa 12649



to top

>emb|AL163151.1|CNS01RIC Human chromosome 14 DNA sequence BAC R-138H18 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 150572

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 71     ttagcttcgtcatctgcaaaatt 93
              |||||||| ||||||||||||||
Sbjct: 137832 ttagcttcctcatctgcaaaatt 137854



to top

>emb|AL157690.7|CNS01RG2 Human chromosome 14 DNA sequence BAC R-565E24 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 163398

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 45     tcaacaatggtacaaaatattaa 67
              ||||||||||| |||||||||||
Sbjct: 108120 tcaacaatggtccaaaatattaa 108098


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,845,189
Number of Sequences: 3902068
Number of extensions: 1845189
Number of successful extensions: 124965
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124442
Number of HSP's gapped (non-prelim): 523
length of query: 189
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 167
effective length of database: 17,147,199,772
effective search space: 2863582361924
effective search space used: 2863582361924
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top