>ref|NM_196939.1| Oryza sativa (japonica cultivar-group) putative protein kinase
            (OSJNBa0006L06.21), mRNA
          Length = 3837

 Score =  214 bits (108), Expect = 2e-52
 Identities = 243/288 (84%)
 Strand = Plus / Minus

                                                                        
Query: 178  tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 237
            ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 3837 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 3778

                                                                        
Query: 238  ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 297
            ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 3777 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 3718

                                                                        
Query: 298  atttaccctggtgcaggcaagcgctatcctgacgatgaacacaacctcttctgcaagctg 357
             || ||||| |||||  ||||||| || || ||||||||||| ||||||||||| |||||
Sbjct: 3717 gttcacccttgtgcaaccaagcgcgattctcacgatgaacacgacctcttctgcgagctg 3658

                                                                        
Query: 358  ttccgttggaggatccaaccgctggtccagtatgtccttgaggagtaaatcgtcttcttg 417
              | ||||||| ||||| ||||||||| |||||||||||||| |||| ||| ||||||| 
Sbjct: 3657 ccctgttggagcatccagccgctggtctagtatgtccttgagcagtagatcatcttcttc 3598

                                                            
Query: 418  tgatgaggatatcgccggcagagaggttagcaagtcacctgggtgctt 465
            |||||| || || || ||||| || ||||  | |||||||||||||||
Sbjct: 3597 tgatgatgagatggctggcagggatgttaagaggtcacctgggtgctt 3550

>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete
              sequence
          Length = 162339

 Score =  214 bits (108), Expect = 2e-52
 Identities = 243/288 (84%)
 Strand = Plus / Minus

                                                                          
Query: 178    tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 237
              ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 146110 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 146051

                                                                          
Query: 238    ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 297
              ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 146050 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 145991

                                                                          
Query: 298    atttaccctggtgcaggcaagcgctatcctgacgatgaacacaacctcttctgcaagctg 357
               || ||||| |||||  ||||||| || || ||||||||||| ||||||||||| |||||
Sbjct: 145990 gttcacccttgtgcaaccaagcgcgattctcacgatgaacacgacctcttctgcgagctg 145931

                                                                          
Query: 358    ttccgttggaggatccaaccgctggtccagtatgtccttgaggagtaaatcgtcttcttg 417
                | ||||||| ||||| ||||||||| |||||||||||||| |||| ||| ||||||| 
Sbjct: 145930 ccctgttggagcatccagccgctggtctagtatgtccttgagcagtagatcatcttcttc 145871

                                                              
Query: 418    tgatgaggatatcgccggcagagaggttagcaagtcacctgggtgctt 465
              |||||| || || || ||||| || ||||  | |||||||||||||||
Sbjct: 145870 tgatgatgagatggctggcagggatgttaagaggtcacctgggtgctt 145823

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  214 bits (108), Expect = 2e-52
 Identities = 243/288 (84%)
 Strand = Plus / Minus

                                                                            
Query: 178      tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 237
                ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 16801593 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 16801534

                                                                            
Query: 238      ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 297
                ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 16801533 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 16801474

                                                                            
Query: 298      atttaccctggtgcaggcaagcgctatcctgacgatgaacacaacctcttctgcaagctg 357
                 || ||||| |||||  ||||||| || || ||||||||||| ||||||||||| |||||
Sbjct: 16801473 gttcacccttgtgcaaccaagcgcgattctcacgatgaacacgacctcttctgcgagctg 16801414

                                                                            
Query: 358      ttccgttggaggatccaaccgctggtccagtatgtccttgaggagtaaatcgtcttcttg 417
                  | ||||||| ||||| ||||||||| |||||||||||||| |||| ||| ||||||| 
Sbjct: 16801413 ccctgttggagcatccagccgctggtctagtatgtccttgagcagtagatcatcttcttc 16801354

                                                                
Query: 418      tgatgaggatatcgccggcagagaggttagcaagtcacctgggtgctt 465
                |||||| || || || ||||| || ||||  | |||||||||||||||
Sbjct: 16801353 tgatgatgagatggctggcagggatgttaagaggtcacctgggtgctt 16801306

>dbj|AK120876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027F13, full
            insert sequence
          Length = 4032

 Score =  214 bits (108), Expect = 2e-52
 Identities = 243/288 (84%)
 Strand = Plus / Minus

                                                                        
Query: 178  tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 237
            ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 3713 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 3654

                                                                        
Query: 238  ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 297
            ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 3653 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 3594

                                                                        
Query: 298  atttaccctggtgcaggcaagcgctatcctgacgatgaacacaacctcttctgcaagctg 357
             || ||||| |||||  ||||||| || || ||||||||||| ||||||||||| |||||
Sbjct: 3593 gttcacccttgtgcaaccaagcgcgattctcacgatgaacacgacctcttctgcgagctg 3534

                                                                        
Query: 358  ttccgttggaggatccaaccgctggtccagtatgtccttgaggagtaaatcgtcttcttg 417
              | ||||||| ||||| ||||||||| |||||||||||||| |||| ||| ||||||| 
Sbjct: 3533 ccctgttggagcatccagccgctggtctagtatgtccttgagcagtagatcatcttcttc 3474

                                                            
Query: 418  tgatgaggatatcgccggcagagaggttagcaagtcacctgggtgctt 465
            |||||| || || || ||||| || ||||  | |||||||||||||||
Sbjct: 3473 tgatgatgagatggctggcagggatgttaagaggtcacctgggtgctt 3426

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  214 bits (108), Expect = 2e-52
 Identities = 243/288 (84%)
 Strand = Plus / Minus

                                                                            
Query: 178      tcacttctggtagtctgttagtttgcttattgtgatgagtctgaatgcttcagagaggta 237
                ||||||||||||||||||||| ||||| |||||||| ||| |||||| ||||||||||||
Sbjct: 16810633 tcacttctggtagtctgttagcttgctaattgtgatcagtttgaatggttcagagaggta 16810574

                                                                            
Query: 238      ggcctgggtatgtgctgatatctcttgtgctacagatcgcattgcaggccttgattcagg 297
                ||| || ||||| || || ||||| || |||||||||| ||| | |||||| ||||||||
Sbjct: 16810573 ggcttgagtatgcgcagaaatctcctgcgctacagatctcatggaaggcctggattcagg 16810514

                                                                            
Query: 298      atttaccctggtgcaggcaagcgctatcctgacgatgaacacaacctcttctgcaagctg 357
                 || ||||| |||||  ||||||| || || ||||||||||| ||||||||||| |||||
Sbjct: 16810513 gttcacccttgtgcaaccaagcgcgattctcacgatgaacacgacctcttctgcgagctg 16810454

                                                                            
Query: 358      ttccgttggaggatccaaccgctggtccagtatgtccttgaggagtaaatcgtcttcttg 417
                  | ||||||| ||||| ||||||||| |||||||||||||| |||| ||| ||||||| 
Sbjct: 16810453 ccctgttggagcatccagccgctggtctagtatgtccttgagcagtagatcatcttcttc 16810394

                                                                
Query: 418      tgatgaggatatcgccggcagagaggttagcaagtcacctgggtgctt 465
                |||||| || || || ||||| || ||||  | |||||||||||||||
Sbjct: 16810393 tgatgatgagatggctggcagggatgttaagaggtcacctgggtgctt 16810346

>gb|AC140403.3| Mus musculus BAC clone RP23-144M22 from 15, complete sequence
          Length = 192144

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 189  agtctgttagtttgcttattgt 210
            ||||||||||||||||||||||
Sbjct: 9319 agtctgttagtttgcttattgt 9340

>gb|BC074227.1| Xenopus laevis NIMA-family kinase Nercc1, mRNA (cDNA clone
           MGC:83419 IMAGE:7008816), complete cds
          Length = 3112

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 94  gatttgaaactgtattttaca 114
           |||||||||||||||||||||
Sbjct: 664 gatttgaaactgtattttaca 644

>gb|AY271412.1| Xenopus laevis NIMA-family kinase Nercc1 mRNA, complete cds
          Length = 2835

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 94  gatttgaaactgtattttaca 114
           |||||||||||||||||||||
Sbjct: 641 gatttgaaactgtattttaca 621

>gb|AC074270.25|AC074270 Homo sapiens 12 BAC RP11-84G21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 140597

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 244   ggtatgtgctgatatctcttgtgct 268
             ||||||||||||||||| |||||||
Sbjct: 99671 ggtatgtgctgatatctattgtgct 99647

>gb|BC044295.1| Xenopus laevis, Similar to NIMA (never in mitosis gene a)- related
           kinase 9, clone IMAGE:5569930, mRNA
          Length = 3289

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 94  gatttgaaactgtattttaca 114
           |||||||||||||||||||||
Sbjct: 689 gatttgaaactgtattttaca 669

>emb|CR926129.9| Zebrafish DNA sequence from clone DKEY-261J15 in linkage group 6,
             complete sequence
          Length = 142272

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 247   atgtgctgatatctcttgtg 266
             ||||||||||||||||||||
Sbjct: 31770 atgtgctgatatctcttgtg 31789

>gb|AC125142.4| Mus musculus BAC clone RP24-342G10 from chromosome 12, complete sequence
          Length = 174908

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 3      atagcttagctatctatttt 22
              ||||||||||||||||||||
Sbjct: 129583 atagcttagctatctatttt 129602

>gb|AC129851.5| Homo sapiens X BAC RP11-669P14 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 166653

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 43     ctctcctaatgctggtcttt 62
              ||||||||||||||||||||
Sbjct: 115651 ctctcctaatgctggtcttt 115670

>gb|AC129852.5| Homo sapiens X BAC RP11-540E20 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 170072

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 43   ctctcctaatgctggtcttt 62
            ||||||||||||||||||||
Sbjct: 3813 ctctcctaatgctggtcttt 3832

>emb|BX070169.1|CNS09QB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 719

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 107 gttagtttgcttattgtgat 88

>emb|BX064290.1|CNS09LRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 129 gttagtttgcttattgtgat 110

>emb|BX058290.1|CNS09H52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 507

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 182 gttagtttgcttattgtgat 163

>emb|BX056496.1|CNS09FR8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 94  gttagtttgcttattgtgat 75

>emb|BX053036.1|CNS09D34 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 729

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 103 gttagtttgcttattgtgat 84

>emb|BX054415.1|CNS09E5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 254 gttagtttgcttattgtgat 235

>emb|BX031025.1|CNS08W3P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 54  gttagtttgcttattgtgat 35

>emb|BX030933.1|CNS08W15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 273 gttagtttgcttattgtgat 254

>emb|BX035628.1|CNS08ZNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 448

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 298 gttagtttgcttattgtgat 279

>emb|BX035345.1|CNS08ZFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 118 gttagtttgcttattgtgat 99

>emb|BX033736.1|CNS08Y70 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 200 gttagtttgcttattgtgat 181

>emb|BX023661.1|CNS08QF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 137 gttagtttgcttattgtgat 118

>emb|BX015096.1|CNS08JT8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 482 gttagtttgcttattgtgat 463

>emb|BX011577.1|CNS08H3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gttagtttgcttattgtgat 213
           ||||||||||||||||||||
Sbjct: 176 gttagtttgcttattgtgat 157

>gb|AE016828.2| Coxiella burnetii RSA 493, complete genome
          Length = 1995281

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    aagtacttgaggatttgaaa 102
             ||||||||||||||||||||
Sbjct: 80653 aagtacttgaggatttgaaa 80672

>emb|AL683843.9| Mouse DNA sequence from clone RP23-217E1 on chromosome 11 Contains part
             of the Ranbp17 gene for RAN binding protein 17, an acidic
             (leucine-rich) nuclear phosphoprotein 32 family, member E
             (Anp32e) pseudogene and a high mobility group box 1
             (Hmgb1) pseudogene, complete sequence
          Length = 198926

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    ttgaggatttgaaactgtat 108
             ||||||||||||||||||||
Sbjct: 27038 ttgaggatttgaaactgtat 27019

>emb|BX323012.5| Zebrafish DNA sequence from clone DKEYP-46F3, complete sequence
          Length = 175238

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 117    attaataagtctgcaatttt 136
              ||||||||||||||||||||
Sbjct: 135107 attaataagtctgcaatttt 135126

>dbj|AK053392.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130013L03 product:unclassifiable, full
            insert sequence
          Length = 3233

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   ttgaggatttgaaactgtat 108
            ||||||||||||||||||||
Sbjct: 3027 ttgaggatttgaaactgtat 3046

>gb|AC155258.2| Mus musculus BAC clone RP24-83B1 from 12, complete sequence
          Length = 221264

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 226   ttcagagaggtaggcctggg 245
             ||||||||||||||||||||
Sbjct: 75631 ttcagagaggtaggcctggg 75612

>emb|CT572998.9| Mouse DNA sequence from clone RP23-26C23 on chromosome 12, complete
              sequence
          Length = 180742

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 226    ttcagagaggtaggcctggg 245
              ||||||||||||||||||||
Sbjct: 137460 ttcagagaggtaggcctggg 137441

>emb|AL954867.12| Zebrafish DNA sequence from clone DKEY-1G17 in linkage group 6, complete
              sequence
          Length = 222787

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    atgtgctgatatctcttgtg 266
              ||||||||||||||||||||
Sbjct: 161042 atgtgctgatatctcttgtg 161061

>dbj|AP006423.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT23C14, TM0311,
             complete sequence
          Length = 82652

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 410   tcttcttgtgatgaggatat 429
             ||||||||||||||||||||
Sbjct: 47821 tcttcttgtgatgaggatat 47802


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,891,575
Number of Sequences: 3902068
Number of extensions: 3891575
Number of successful extensions: 66597
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66514
Number of HSP's gapped (non-prelim): 83
length of query: 466
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 444
effective length of database: 17,147,199,772
effective search space: 7613356698768
effective search space used: 7613356698768
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)