ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl40b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC122717.2| Homo sapiens chromosome 5 clone RP11-60H3, comple... 42 0.75
2gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Can... 42 0.75
3ref|XM_223830.3| PREDICTED: Rattus norvegicus similar to hypothe... 42 0.75
4gb|AC015684.11| Homo sapiens chromosome 11, clone RP11-2C23, com... 40 3.0
5ref|NM_024381.1| Rattus norvegicus glycerol kinase (Gyk), mRNA 40 3.0
6ref|XM_579490.1| PREDICTED: Rattus norvegicus hypothetical gene ... 40 3.0
7gb|AY135690.1| Mus musculus argonaute 4 protein (Ago4) gene, com... 40 3.0
8emb|Y09448.1|PV09448 P.vulgaris immature mRNA for cinnamate 4-hy... 40 3.0
9emb|Y09447.1|PV09447 P.vulgaris mRNA for cinnamate 4-hydroxylase 40 3.0
10dbj|AP006305.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 3.0
11dbj|AP006301.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 3.0
12gb|AC092818.4| Homo sapiens chromosome 8, clone RP11-419C23, com... 40 3.0
13emb|AL606935.8| Mouse DNA sequence from clone RP23-204N19 on chr... 40 3.0
14dbj|D16102.1|RATASTP Rattus norvegicus mRNA for ATP-stimulated g... 40 3.0

>gb|AC122717.2| Homo sapiens chromosome 5 clone RP11-60H3, complete sequence
          Length = 120125

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 87    caacatcaaagctatttgaaa 107
             |||||||||||||||||||||
Sbjct: 25953 caacatcaaagctatttgaaa 25973



to top

>gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 201801

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     aaatccagttttctccacata 26
             |||||||||||||||||||||
Sbjct: 97707 aaatccagttttctccacata 97687



to top

>ref|XM_223830.3| PREDICTED: Rattus norvegicus similar to hypothetical protein
           FLJ23834 (LOC289926), mRNA
          Length = 2331

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 5   caaatccagttttctccacat 25
           |||||||||||||||||||||
Sbjct: 898 caaatccagttttctccacat 878



to top

>gb|AC015684.11| Homo sapiens chromosome 11, clone RP11-2C23, complete sequence
          Length = 183939

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     taatggaacttagcttcagt 83
              ||||||||||||||||||||
Sbjct: 136556 taatggaacttagcttcagt 136575



to top

>ref|NM_024381.1| Rattus norvegicus glycerol kinase (Gyk), mRNA
          Length = 2989

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tttccaacatcaaagctatt 102
           ||||||||||||||||||||
Sbjct: 344 tttccaacatcaaagctatt 363



to top

>ref|XM_579490.1| PREDICTED: Rattus norvegicus hypothetical gene supported by
           NM_024381 (LOC497845), mRNA
          Length = 2985

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tttccaacatcaaagctatt 102
           ||||||||||||||||||||
Sbjct: 341 tttccaacatcaaagctatt 360



to top

>gb|AY135690.1| Mus musculus argonaute 4 protein (Ago4) gene, complete cds
          Length = 92047

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tttctccacatacacaaaaa 34
             ||||||||||||||||||||
Sbjct: 52373 tttctccacatacacaaaaa 52354



to top

>emb|Y09448.1|PV09448 P.vulgaris immature mRNA for cinnamate 4-hydroxylase, partial
          Length = 2280

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 20 ccacatacacaaaaatgagt 39
          ||||||||||||||||||||
Sbjct: 1  ccacatacacaaaaatgagt 20



to top

>emb|Y09447.1|PV09447 P.vulgaris mRNA for cinnamate 4-hydroxylase
          Length = 1799

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 20 ccacatacacaaaaatgagt 39
          ||||||||||||||||||||
Sbjct: 1  ccacatacacaaaaatgagt 20



to top

>dbj|AP006305.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53M8, complete
             sequence
          Length = 185588

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 154   acctgcaatttcaaacatcatact 177
             |||||||| |||||||||||||||
Sbjct: 41498 acctgcaacttcaaacatcatact 41475



to top

>dbj|AP006301.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-139F6, complete
              sequence
          Length = 163604

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 154    acctgcaatttcaaacatcatact 177
              |||||||| |||||||||||||||
Sbjct: 126032 acctgcaacttcaaacatcatact 126009



to top

>gb|AC092818.4| Homo sapiens chromosome 8, clone RP11-419C23, complete sequence
          Length = 175100

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 154   acctgcaatttcaaacatcatact 177
             |||||||| |||||||||||||||
Sbjct: 90705 acctgcaacttcaaacatcatact 90728



to top

>emb|AL606935.8| Mouse DNA sequence from clone RP23-204N19 on chromosome 4, complete
             sequence
          Length = 213391

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    tttctccacatacacaaaaa 34
             ||||||||||||||||||||
Sbjct: 65792 tttctccacatacacaaaaa 65811



to top

>dbj|D16102.1|RATASTP Rattus norvegicus mRNA for ATP-stimulated glucocorticoid-receptor
           translocaton promoter, complete cds
          Length = 2989

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tttccaacatcaaagctatt 102
           ||||||||||||||||||||
Sbjct: 344 tttccaacatcaaagctatt 363


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,667,913
Number of Sequences: 3902068
Number of extensions: 2667913
Number of successful extensions: 50863
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50847
Number of HSP's gapped (non-prelim): 16
length of query: 232
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 210
effective length of database: 17,147,199,772
effective search space: 3600911952120
effective search space used: 3600911952120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top