ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl39h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT019213.1| Zea mays clone Contig886.F mRNA sequence 58 2e-05
2dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
3dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
4dbj|AK111781.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
5dbj|AK111741.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
6dbj|AK104898.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
7gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 58 2e-05
8gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 58 2e-05
9emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa... 58 2e-05
10emb|BX000494.2|CNS08CDK Oryza sativa chromosome 12, . BAC OSJNBa... 58 2e-05
11emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa... 58 2e-05
12gb|M55604.1|WHTUBA1 T.aestivum ubiquitin activating enzyme E1 (U... 58 2e-05
13gb|M90663.1|WHTE1A Wheat ubiquitin activating enzyme (E1) mRNA, ... 50 0.004
14emb|AJ299395.1|CAR299395 Cicer arietinum partial mRNA for ubiqui... 48 0.016
15ref|NM_128566.3| Arabidopsis thaliana ATUBA1; ubiquitin activati... 46 0.064
16ref|XM_710731.1| Candida albicans SC5314 hypothetical protein (C... 46 0.064
17ref|XM_710680.1| Candida albicans SC5314 hypothetical protein (C... 46 0.064
18gb|AC004165.3| Arabidopsis thaliana chromosome 2 clone T27E13 ma... 46 0.064
19gb|AY090248.1| Arabidopsis thaliana At2g30110/T27E13.15 mRNA, co... 46 0.064
20dbj|AK220705.1| Arabidopsis thaliana mRNA for putative ubiquitin... 46 0.064
21gb|BT006363.1| Arabidopsis thaliana At2g30110/T27E13.15 gene, co... 46 0.064
22gb|U80808.1|ATU80808 Arabidopsis thaliana ubiquitin activating e... 46 0.064
23emb|BX821151.1|CNS0AAA1 Arabidopsis thaliana Full-length cDNA Co... 46 0.064
24emb|BX820519.1|CNS0A9M5 Arabidopsis thaliana Full-length cDNA Co... 46 0.064
25emb|BX820277.1|CNS0A9OY Arabidopsis thaliana Full-length cDNA Co... 46 0.064
26emb|AL583824.16| Human DNA sequence from clone RP11-79M19 on chr... 44 0.25
27emb|AL627182.22| Mouse DNA sequence from clone RP23-32K12 on chr... 44 0.25
28gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 42 1.0
29gb|AC022522.2|AC022522 Arabidopsis thaliana chromosome I BAC T28... 42 1.0
30gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 ... 42 1.0
31gb|AF000580.1|AF000580 Dictyostelium discoideum plasmid Ddp5, co... 42 1.0
32emb|BX004887.2| Zebrafish DNA sequence from clone CH211-150E4, c... 42 1.0
33emb|BX897750.11| Zebrafish DNA sequence from clone DKEY-278N18, ... 42 1.0
34gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom... 40 4.0
35ref|XM_640831.1| Dictyostelium discoideum putative protein tyros... 40 4.0
36gb|AC154392.18| Mus musculus chromosome 1, clone RP23-413K6, com... 40 4.0
37gb|AE017139.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 4.0
38ref|XM_365395.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 4.0
39ref|XM_461467.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 4.0
40gb|AC140247.3| Mus musculus BAC clone RP23-469I15 from chromosom... 40 4.0
41gb|AE009952.1| Yersinia pestis KIM, complete genome 40 4.0
42ref|XM_857646.1| PREDICTED: Canis familiaris similar to PGC-1 re... 40 4.0
43ref|XM_534998.2| PREDICTED: Canis familiaris similar to PGC-1 re... 40 4.0
44gb|AC116592.5| Mus musculus BAC clone RP24-90K3 from 2, complete... 40 4.0
45emb|AL355384.6| Human DNA sequence from clone RP11-626C11 on chr... 40 4.0
46gb|U58632.2|TNU58632 Thermotoga neapolitana xylan catabolic clus... 40 4.0
47emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS... 40 4.0
48emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 4.0
49emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chrom... 40 4.0
50emb|AJ414159.1| Yersinia pestis strain CO92 complete genome; seg... 40 4.0
51gb|AC163436.3| Mus musculus chromosome 1, clone RP23-102H12, com... 40 4.0
52gb|AC090541.4| Homo sapiens chromosome 8, clone RP11-1105O14, co... 40 4.0
53emb|BX276181.15| Zebrafish DNA sequence from clone CH211-247O20 ... 40 4.0
54dbj|AB077116.1| Prunus persica mRNA, microsatellite marker M13b 40 4.0
55gb|AC083837.4| Homo sapiens chromosome 8, clone RP11-79H23, comp... 40 4.0
56gb|AC024993.6| Homo sapiens chromosome 8, clone RP11-262B3, comp... 40 4.0
57gb|AC016031.6| Homo sapiens, clone RP11-12J8, complete sequence 40 4.0
58gb|AC157477.2| Mus musculus BAC clone RP24-141A7 from chromosome... 40 4.0
59gb|AY170918.1| Dictyostelium discoideum pats1 gene, partial cds 40 4.0
60gb|AC097231.3| Sus scrofa clone RP44-504L18, complete sequence 40 4.0
61gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, co... 40 4.0
62emb|AL845529.10| Mouse DNA sequence from clone RP23-276D17 on ch... 40 4.0

>gb|BT019213.1| Zea mays clone Contig886.F mRNA sequence
          Length = 836

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 251 cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
           |||||||| | ||| || || |||||||| |||||||||||||||||||||||
Sbjct: 779 cggaagtaaatagacacaagcgggatgtcgacgtcattgtcatcgtcatcctc 727



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 251    cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
              ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 312156 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 312208



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11,
              complete sequence
          Length = 28386948

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 251    cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
              ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 295054 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 295106



to top

>dbj|AK111781.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023083B12, full
            insert sequence
          Length = 3724

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 251  cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 3463 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 3411



to top

>dbj|AK111741.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023049I12, full
            insert sequence
          Length = 1533

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 251  cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 1356 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 1304



to top

>dbj|AK104898.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C03, full
            insert sequence
          Length = 1510

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 251  cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 1247 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 1195



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 251    cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
              ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 295054 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 295106



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 251    cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
              ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 312156 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 312208



to top

>emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa0032J07 of library OSJNBa
            from chromosome 11 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 160673

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 251  cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 9939 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 9887



to top

>emb|BX000494.2|CNS08CDK Oryza sativa chromosome 12, . BAC OSJNBa0052H10 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 152222

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 251   cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
             ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 45207 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 45259



to top

>emb|BX000497.1|CNS08CDN Oryza sativa chromosome 11, . BAC OSJNBa0010K05 of library OSJNBa
            from chromosome 11 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 164143

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 251  cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            ||||||||||  ||||| ||||||||||||||||| |||||||| || |||||
Sbjct: 2372 cggaagtagattgataccagtgggatgtcaacgtcgttgtcatcatcgtcctc 2424



to top

>gb|M55604.1|WHTUBA1 T.aestivum ubiquitin activating enzyme E1 (UBA1) gene, complete cds
          Length = 3586

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 251  cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            ||||||||||| || || ||||||||||| || |||||||| |||||||||||
Sbjct: 3334 cggaagtagaccgacacaagtgggatgtcgacatcattgtcgtcgtcatcctc 3282



to top

>gb|M90663.1|WHTE1A Wheat ubiquitin activating enzyme (E1) mRNA, complete cds
          Length = 3695

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 251  cggaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            ||||||||||| || || ||||||||||| || || ||||| |||||||||||
Sbjct: 3429 cggaagtagaccgacacaagtgggatgtcgacatcgttgtcgtcgtcatcctc 3377



to top

>emb|AJ299395.1|CAR299395 Cicer arietinum partial mRNA for ubiquitin activating enzyme E1
           (ORF), clone CanUBC-1
          Length = 807

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 272 gggatgtcaacgtcattgtcatcgtcatcctc 303
           ||||| |||| |||||||||||||||||||||
Sbjct: 499 gggatatcaatgtcattgtcatcgtcatcctc 468



to top

>ref|NM_128566.3| Arabidopsis thaliana ATUBA1; ubiquitin activating enzyme AT2G30110
            (ATUBA1) mRNA, complete cds
          Length = 3626

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 253  gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 3360 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 3310



to top

>ref|XM_710731.1| Candida albicans SC5314 hypothetical protein (CaO19_10361), mRNA
          Length = 2148

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 278  tcaacgtcattgtcatcgtcatc 300
            |||||||||||||||||||||||
Sbjct: 1177 tcaacgtcattgtcatcgtcatc 1199



to top

>ref|XM_710680.1| Candida albicans SC5314 hypothetical protein (CaO19_2842), mRNA
          Length = 2133

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 278  tcaacgtcattgtcatcgtcatc 300
            |||||||||||||||||||||||
Sbjct: 1150 tcaacgtcattgtcatcgtcatc 1172



to top

>gb|AC004165.3| Arabidopsis thaliana chromosome 2 clone T27E13 map m283, complete
             sequence
          Length = 83796

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 253   gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
             |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 53002 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 52952



to top

>gb|AY090248.1| Arabidopsis thaliana At2g30110/T27E13.15 mRNA, complete cds
          Length = 3561

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 253  gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 3321 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 3271



to top

>dbj|AK220705.1| Arabidopsis thaliana mRNA for putative ubiquitin activating enzyme,
           complete cds, clone: RAFL22-01-B01
          Length = 474

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 253 gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
           |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 208 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 158



to top

>gb|BT006363.1| Arabidopsis thaliana At2g30110/T27E13.15 gene, complete cds
          Length = 3243

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 253  gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 3237 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 3187



to top

>gb|U80808.1|ATU80808 Arabidopsis thaliana ubiquitin activating enzyme (UBA1) gene,
            complete cds
          Length = 3346

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 253  gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 3334 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 3284



to top

>emb|BX821151.1|CNS0AAA1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL1ZD10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 646

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 253 gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
           |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 390 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 340



to top

>emb|BX820519.1|CNS0A9M5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH43ZE11 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1375

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 253  gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
            |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 1167 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 1117



to top

>emb|BX820277.1|CNS0A9OY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH16ZF09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 253 gaagtagacagatacgagtgggatgtcaacgtcattgtcatcgtcatcctc 303
           |||||||| ||| ||||| || || || |||||||||||||| ||||||||
Sbjct: 673 gaagtagatagagacgagaggaatatcgacgtcattgtcatcttcatcctc 623



to top

>emb|AL583824.16| Human DNA sequence from clone RP11-79M19 on chromosome 10 Contains part
             of the GPRK5 gene for G protein-coupled receptor kinase 5
             (GRK5) and a novel gene, complete sequence
          Length = 55700

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 282   cgtcattgtcatcgtcatcctc 303
             ||||||||||||||||||||||
Sbjct: 10385 cgtcattgtcatcgtcatcctc 10406



to top

>emb|AL627182.22| Mouse DNA sequence from clone RP23-32K12 on chromosome 4, complete
              sequence
          Length = 241562

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 274    gatgtcaacgtcattgtcatcgtcatcctc 303
              |||||||||||||||||| || ||||||||
Sbjct: 156105 gatgtcaacgtcattgtcctcatcatcctc 156134



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 233     cagaggggagcctgtcaacgg 253
               |||||||||||||||||||||
Sbjct: 2835519 cagaggggagcctgtcaacgg 2835499



to top

>gb|AC022522.2|AC022522 Arabidopsis thaliana chromosome I BAC T28K15 genomic sequence, complete
             sequence
          Length = 88643

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 153   ataataataactactactgta 173
             |||||||||||||||||||||
Sbjct: 67458 ataataataactactactgta 67478



to top

>gb|AC002131.1|F12F1 Arabidopsis thaliana chromosome 1 BAC F12F1 sequence, complete
            sequence
          Length = 123386

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 153  ataataataactactactgta 173
            |||||||||||||||||||||
Sbjct: 9558 ataataataactactactgta 9578



to top

>gb|AF000580.1|AF000580 Dictyostelium discoideum plasmid Ddp5, complete genome
          Length = 14955

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 276  tgtcaacgtcattgtcatcgtcatc 300
            ||||||||||||||||| |||||||
Sbjct: 1030 tgtcaacgtcattgtcaacgtcatc 1006



 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 276  tgtcaacgtcattgtcatcgtcatc 300
            |||||||||||| ||||||||||||
Sbjct: 1018 tgtcaacgtcatcgtcatcgtcatc 994



to top

>emb|BX004887.2| Zebrafish DNA sequence from clone CH211-150E4, complete sequence
          Length = 186834

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 153   ataataataactactactgtataaa 177
             |||||||||| ||||||||||||||
Sbjct: 93212 ataataataaatactactgtataaa 93188



to top

>emb|BX897750.11| Zebrafish DNA sequence from clone DKEY-278N18, complete sequence
          Length = 182033

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 148   acagtataataataactacta 168
             |||||||||||||||||||||
Sbjct: 38752 acagtataataataactacta 38772



to top

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
             sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 277   gtcaacgtcattgtcatcgtcatc 300
             |||| |||||||||||||||||||
Sbjct: 84338 gtcatcgtcattgtcatcgtcatc 84361



to top

>ref|XM_640831.1| Dictyostelium discoideum putative protein tyrosine kinase
           (DDB0191503), partial mRNA
          Length = 9555

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 152 tataataataactactactg 171
           ||||||||||||||||||||
Sbjct: 742 tataataataactactactg 723



to top

>gb|AC154392.18| Mus musculus chromosome 1, clone RP23-413K6, complete sequence
          Length = 205076

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 73     gaggatctgaactcagctct 92
              ||||||||||||||||||||
Sbjct: 105143 gaggatctgaactcagctct 105124



to top

>gb|AE017139.1| Yersinia pestis biovar Medievalis str. 91001 section 13 of 16 of the
              complete genome
          Length = 294253

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 280    aacgtcattgtcatcgtcat 299
              ||||||||||||||||||||
Sbjct: 212434 aacgtcattgtcatcgtcat 212453



to top

>ref|XM_365395.1| Magnaporthe grisea 70-15 hypothetical protein (MG02097.4) partial
            mRNA
          Length = 2472

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 281  acgtcattgtcatcgtcatc 300
            ||||||||||||||||||||
Sbjct: 2084 acgtcattgtcatcgtcatc 2065



to top

>ref|XM_461467.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F27489g)
            partial mRNA
          Length = 2595

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 277  gtcaacgtcattgtcatcgtcatc 300
            |||| |||||||||||||||||||
Sbjct: 1041 gtcatcgtcattgtcatcgtcatc 1018



to top

>gb|AC140247.3| Mus musculus BAC clone RP23-469I15 from chromosome 9, complete sequence
          Length = 189336

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   acgtcattgtcatcgtcatc 300
             ||||||||||||||||||||
Sbjct: 19542 acgtcattgtcatcgtcatc 19561



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 280     aacgtcattgtcatcgtcat 299
               ||||||||||||||||||||
Sbjct: 4327569 aacgtcattgtcatcgtcat 4327550



to top

>ref|XM_857646.1| PREDICTED: Canis familiaris similar to PGC-1 related co-activator,
           transcript variant 2 (LOC477805), mRNA
          Length = 4914

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 101 ggtgcattggaaagtcagggatattgct 128
           ||||||| |||||||| |||||||||||
Sbjct: 472 ggtgcataggaaagtctgggatattgct 445



to top

>ref|XM_534998.2| PREDICTED: Canis familiaris similar to PGC-1 related co-activator,
           transcript variant 1 (LOC477805), mRNA
          Length = 5283

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 101 ggtgcattggaaagtcagggatattgct 128
           ||||||| |||||||| |||||||||||
Sbjct: 835 ggtgcataggaaagtctgggatattgct 808



to top

>gb|AC116592.5| Mus musculus BAC clone RP24-90K3 from 2, complete sequence
          Length = 238657

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 277    gtcaacgtcattgtcatcgtcatc 300
              |||| |||||||||||||||||||
Sbjct: 129557 gtcatcgtcattgtcatcgtcatc 129580



to top

>emb|AL355384.6| Human DNA sequence from clone RP11-626C11 on chromosome 10 Contains a
             CpG island, complete sequence
          Length = 159305

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   ggtgcattggaaagtcaggg 120
             ||||||||||||||||||||
Sbjct: 20449 ggtgcattggaaagtcaggg 20468



to top

>gb|U58632.2|TNU58632 Thermotoga neapolitana xylan catabolic cluster and associated ABC
            transport system, complete sequence
          Length = 12298

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 188  cactatcttcgttctggaaa 207
            ||||||||||||||||||||
Sbjct: 6190 cactatcttcgttctggaaa 6171



to top

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
               hansenii
          Length = 2336804

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 277     gtcaacgtcattgtcatcgtcatc 300
               |||| |||||||||||||||||||
Sbjct: 2188770 gtcatcgtcattgtcatcgtcatc 2188793



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 280     aacgtcattgtcatcgtcat 299
               ||||||||||||||||||||
Sbjct: 4518728 aacgtcattgtcatcgtcat 4518747



to top

>emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chromosome 5, segment 2/4
          Length = 313050

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 276   tgtcaacgtcattgtcatcgtcat 299
             ||||| ||||||||||||||||||
Sbjct: 66439 tgtcatcgtcattgtcatcgtcat 66416



to top

>emb|AJ414159.1| Yersinia pestis strain CO92 complete genome; segment 19/20
          Length = 199050

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 280    aacgtcattgtcatcgtcat 299
              ||||||||||||||||||||
Sbjct: 190514 aacgtcattgtcatcgtcat 190533



to top

>gb|AC163436.3| Mus musculus chromosome 1, clone RP23-102H12, complete sequence
          Length = 198253

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 284    tcattgtcatcgtcatcctc 303
              ||||||||||||||||||||
Sbjct: 123957 tcattgtcatcgtcatcctc 123938



to top

>gb|AC090541.4| Homo sapiens chromosome 8, clone RP11-1105O14, complete sequence
          Length = 167319

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    caagttcaacaataaatttt 69
             ||||||||||||||||||||
Sbjct: 85537 caagttcaacaataaatttt 85556



to top

>emb|BX276181.15| Zebrafish DNA sequence from clone CH211-247O20 in linkage group 5,
             complete sequence
          Length = 154012

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 144   gtttacagtataataataactact 167
             ||||||||||| ||||||||||||
Sbjct: 97427 gtttacagtattataataactact 97404



to top

>dbj|AB077116.1| Prunus persica mRNA, microsatellite marker M13b
          Length = 615

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 277 gtcaacgtcattgtcatcgtcatc 300
           ||||||||||| ||||||||||||
Sbjct: 69  gtcaacgtcatcgtcatcgtcatc 92



to top

>gb|AC083837.4| Homo sapiens chromosome 8, clone RP11-79H23, complete sequence
          Length = 166114

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 170  tgtataaaggaactcaaaca 189
            ||||||||||||||||||||
Sbjct: 9690 tgtataaaggaactcaaaca 9709



to top

>gb|AC024993.6| Homo sapiens chromosome 8, clone RP11-262B3, complete sequence
          Length = 141756

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 50     caagttcaacaataaatttt 69
              ||||||||||||||||||||
Sbjct: 100382 caagttcaacaataaatttt 100363



to top

>gb|AC016031.6| Homo sapiens, clone RP11-12J8, complete sequence
          Length = 139690

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   tgtataaaggaactcaaaca 189
             ||||||||||||||||||||
Sbjct: 61125 tgtataaaggaactcaaaca 61106



to top

>gb|AC157477.2| Mus musculus BAC clone RP24-141A7 from chromosome 9, complete sequence
          Length = 163557

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 281    acgtcattgtcatcgtcatc 300
              ||||||||||||||||||||
Sbjct: 159041 acgtcattgtcatcgtcatc 159060



to top

>gb|AY170918.1| Dictyostelium discoideum pats1 gene, partial cds
          Length = 8892

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 152 tataataataactactactg 171
           ||||||||||||||||||||
Sbjct: 265 tataataataactactactg 246



to top

>gb|AC097231.3| Sus scrofa clone RP44-504L18, complete sequence
          Length = 161823

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    tcaagttcaacaataaattt 68
             ||||||||||||||||||||
Sbjct: 27526 tcaagttcaacaataaattt 27507



to top

>gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, complete sequence
          Length = 192545

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   tcattgtcatcgtcatcctc 303
             ||||||||||||||||||||
Sbjct: 89486 tcattgtcatcgtcatcctc 89467



to top

>emb|AL845529.10| Mouse DNA sequence from clone RP23-276D17 on chromosome 2, complete
             sequence
          Length = 166971

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 277   gtcaacgtcattgtcatcgtcatc 300
             |||| |||||||||||||||||||
Sbjct: 90493 gtcatcgtcattgtcatcgtcatc 90470


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,867,391
Number of Sequences: 3902068
Number of extensions: 2867391
Number of successful extensions: 56938
Number of sequences better than 10.0: 62
Number of HSP's better than 10.0 without gapping: 62
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56740
Number of HSP's gapped (non-prelim): 198
length of query: 303
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 281
effective length of database: 17,147,199,772
effective search space: 4818363135932
effective search space used: 4818363135932
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top