>emb|AL355504.17| Human DNA sequence from clone RP11-218A18 on chromosome 13 Contains a
             mitochondrial import receptor Tom22 pseudogene, complete
             sequence
          Length = 60159

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 166   aagataaatgcccttgttctccctc 190
             |||||||||||| ||||||||||||
Sbjct: 50666 aagataaatgcctttgttctccctc 50642

>emb|Z92540.1|HS179I15A Human DNA sequence from clone RP1-179I15 on chromosome 13. Contains a
             novel gene, a mitochondrial import receptor TOM22
             pseudogene, the 5' end of the KL gene for klotho, ESTs,
             STSs and a CpG island, complete sequence
          Length = 146810

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 166   aagataaatgcccttgttctccctc 190
             |||||||||||| ||||||||||||
Sbjct: 82429 aagataaatgcctttgttctccctc 82405

>gb|AC151775.1| Ornithorhynchus anatinus chromosome UNK clone OABb-307A1, complete
             sequence
          Length = 195598

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 144   acaaatatttacatttctgc 163
             ||||||||||||||||||||
Sbjct: 62703 acaaatatttacatttctgc 62684

>ref|XM_709233.1| Candida albicans SC5314 putative farnesyl carboxyl
           methyltransferase (CaO19.120), mRNA
          Length = 774

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 112 ggattttggttatattgtat 131
           ||||||||||||||||||||
Sbjct: 577 ggattttggttatattgtat 596

>ref|XM_708958.1| Candida albicans SC5314 putative farnesyl carboxyl
           methyltransferase (CaO19.7767), mRNA
          Length = 771

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 112 ggattttggttatattgtat 131
           ||||||||||||||||||||
Sbjct: 574 ggattttggttatattgtat 593

>gb|AC102575.11| Mus musculus chromosome 14, clone RP23-239P22, complete sequence
          Length = 238123

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 277    cggaactggagataatgaaa 296
              ||||||||||||||||||||
Sbjct: 150119 cggaactggagataatgaaa 150138

>gb|AC117639.7| Mus musculus chromosome 10, clone RP23-225H6, complete sequence
          Length = 217522

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 39     gttttaactaaccgtatgtcacaa 62
              |||||| |||||||||||||||||
Sbjct: 178731 gttttatctaaccgtatgtcacaa 178708

>gb|AC093510.2| Homo sapiens chromosome 5 clone CTD-2373J6, complete sequence
          Length = 125933

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 57     tcacaactgtatacaatgaa 76
              ||||||||||||||||||||
Sbjct: 109378 tcacaactgtatacaatgaa 109397

>gb|AC099497.2| Homo sapiens chromosome 5 clone RP11-139A10, complete sequence
          Length = 165884

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    tcacaactgtatacaatgaa 76
             ||||||||||||||||||||
Sbjct: 20353 tcacaactgtatacaatgaa 20372

>gb|AF028810.2|AF028810 Rhizobium leguminosarum bv. viciae VF39 acidic exopolysaccharide
             biosynthesis gene cluster, complete sequence
          Length = 20766

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 360   gcgcgaaatctggctgatgc 379
             ||||||||||||||||||||
Sbjct: 10648 gcgcgaaatctggctgatgc 10629

>gb|AC097717.3| Homo sapiens BAC clone RP11-650N19 from 2, complete sequence
          Length = 142978

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   agataatgaaaagatgcaca 305
             ||||||||||||||||||||
Sbjct: 49297 agataatgaaaagatgcaca 49278

>gb|AC023468.6| Homo sapiens BAC clone RP11-432O12 from 2, complete sequence
          Length = 170871

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 28     ttttccagattgttttaact 47
              ||||||||||||||||||||
Sbjct: 121913 ttttccagattgttttaact 121894

>gb|AC153897.4| Mus musculus 10 BAC RP23-119E2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 209755

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 39     gttttaactaaccgtatgtcacaa 62
              |||||| |||||||||||||||||
Sbjct: 145976 gttttatctaaccgtatgtcacaa 145999

>emb|AL935058.12| Mouse DNA sequence from clone RP23-409M4 on chromosome 2, complete
             sequence
          Length = 143502

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    caatgaaacaaagagttcat 89
             ||||||||||||||||||||
Sbjct: 97026 caatgaaacaaagagttcat 97007

>gb|AF040104.1|AF040104 Rhizobium leguminosarum bv. trifolii polysaccharide export protein
            (pssL), polysaccharide polymerization protein (pssK), and
            glycosyl transferase homolog (pssI) genes, complete cds
          Length = 4527

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 360  gcgcgaaatctggctgatgc 379
            ||||||||||||||||||||
Sbjct: 2336 gcgcgaaatctggctgatgc 2317


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,593,846
Number of Sequences: 3902068
Number of extensions: 4593846
Number of successful extensions: 134472
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 134429
Number of HSP's gapped (non-prelim): 43
length of query: 413
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 391
effective length of database: 17,147,199,772
effective search space: 6704555110852
effective search space used: 6704555110852
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)