ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl39c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC041761.2| Homo sapiens dedicator of cytokinesis 5, mRNA (cD... 42 1.1
2gb|BC057384.1| Homo sapiens dedicator of cytokinesis 5, mRNA (cD... 42 1.1
3emb|CR933718.1| Homo sapiens mRNA; cDNA DKFZp779M164 (from clone... 42 1.1
4emb|CR627414.1| Homo sapiens mRNA; cDNA DKFZp451J181 (from clone... 42 1.1
5dbj|AK126249.1| Homo sapiens cDNA FLJ44261 fis, clone TLIVE20013... 42 1.1
6ref|NM_024940.5| Homo sapiens dedicator of cytokinesis 5 (DOCK5)... 42 1.1
7gb|AC091185.6| Homo sapiens chromosome 8, clone RP11-395I14, com... 42 1.1
8gb|AC099476.6| Rattus norvegicus BAC CH230-159G8 (Children's Ho... 42 1.1
9gb|AC128966.4| Rattus norvegicus BAC CH230-194D11 (Children's H... 42 1.1
10emb|BX648352.1|HSM808500 Homo sapiens mRNA; cDNA DKFZp686D14185 ... 42 1.1
11ref|NM_174324.2| Bos taurus adenylate cyclase-inhibiting G alpha... 40 4.4
12gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosom... 40 4.4
13ref|XM_535402.2| PREDICTED: Canis familiaris similar to guanine ... 40 4.4
14gb|AC138400.12| Mus musculus chromosome 14, clone RP23-260C21, c... 40 4.4
15emb|BX324199.7| Zebrafish DNA sequence from clone DKEYP-7D4 in l... 40 4.4
16emb|CR956396.6| Pig DNA sequence from clone CH242-205N12 on chro... 40 4.4
17emb|AL591851.12| Mouse DNA sequence from clone RP23-43M4 on chro... 40 4.4
18gb|BC105419.1| Bos taurus adenylate cyclase-inhibiting G alpha p... 40 4.4
19emb|BX004772.17| Zebrafish DNA sequence from clone DKEY-15L1 in ... 40 4.4
20emb|AL954383.13| Zebrafish DNA sequence from clone CH211-226M11 ... 40 4.4
21gb|AC108670.10| Homo sapiens 3 BAC RP11-218A22 (Roswell Park Can... 40 4.4
22gb|AC163039.6| Mus musculus BAC clone RP23-188J1 from chromosome... 40 4.4
23emb|AL672242.12| Mouse DNA sequence from clone RP23-83P17 on chr... 40 4.4
24emb|X03642.1|BTGIAR Bovine mRNA for alpha-subunit of G(i) protei... 40 4.4

>gb|BC041761.2| Homo sapiens dedicator of cytokinesis 5, mRNA (cDNA clone
            IMAGE:3912471), partial cds
          Length = 4186

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 264  agcaactgggttcagcagcatgcct 288
            |||||||| ||||||||||||||||
Sbjct: 1355 agcaactgtgttcagcagcatgcct 1379



to top

>gb|BC057384.1| Homo sapiens dedicator of cytokinesis 5, mRNA (cDNA clone
           IMAGE:4283490), partial cds
          Length = 1185

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 264 agcaactgggttcagcagcatgcct 288
           |||||||| ||||||||||||||||
Sbjct: 80  agcaactgtgttcagcagcatgcct 56



to top

>emb|CR933718.1| Homo sapiens mRNA; cDNA DKFZp779M164 (from clone DKFZp779M164)
          Length = 3719

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 264  agcaactgggttcagcagcatgcct 288
            |||||||| ||||||||||||||||
Sbjct: 3348 agcaactgtgttcagcagcatgcct 3372



to top

>emb|CR627414.1| Homo sapiens mRNA; cDNA DKFZp451J181 (from clone DKFZp451J181)
          Length = 5480

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 264 agcaactgggttcagcagcatgcct 288
           |||||||| ||||||||||||||||
Sbjct: 8   agcaactgtgttcagcagcatgcct 32



to top

>dbj|AK126249.1| Homo sapiens cDNA FLJ44261 fis, clone TLIVE2001327, moderately
            similar to Human DOCK180 protein mRNA
          Length = 3434

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 264  agcaactgggttcagcagcatgcct 288
            |||||||| ||||||||||||||||
Sbjct: 1893 agcaactgtgttcagcagcatgcct 1917



to top

>ref|NM_024940.5| Homo sapiens dedicator of cytokinesis 5 (DOCK5), mRNA
          Length = 7555

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 264  agcaactgggttcagcagcatgcct 288
            |||||||| ||||||||||||||||
Sbjct: 4725 agcaactgtgttcagcagcatgcct 4749



to top

>gb|AC091185.6| Homo sapiens chromosome 8, clone RP11-395I14, complete sequence
          Length = 189018

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 264   agcaactgggttcagcagcatgcct 288
             |||||||| ||||||||||||||||
Sbjct: 31064 agcaactgtgttcagcagcatgcct 31040



to top

>gb|AC099476.6| Rattus norvegicus  BAC CH230-159G8 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 208229

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 13     aatttcctccacttgcttggtaact 37
              ||||||||||||||||||| |||||
Sbjct: 196570 aatttcctccacttgcttgttaact 196546



to top

>gb|AC128966.4| Rattus norvegicus  BAC CH230-194D11 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 214096

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 13     aatttcctccacttgcttggtaact 37
              ||||||||||||||||||| |||||
Sbjct: 175311 aatttcctccacttgcttgttaact 175335



to top

>emb|BX648352.1|HSM808500 Homo sapiens mRNA; cDNA DKFZp686D14185 (from clone DKFZp686D14185)
          Length = 4931

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 264  agcaactgggttcagcagcatgcct 288
            |||||||| ||||||||||||||||
Sbjct: 2866 agcaactgtgttcagcagcatgcct 2890



to top

>ref|NM_174324.2| Bos taurus adenylate cyclase-inhibiting G alpha protein (GNAI1), mRNA
          Length = 3099

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   aaatttcctccacttgcttg 31
            ||||||||||||||||||||
Sbjct: 2352 aaatttcctccacttgcttg 2371



to top

>gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosome 14, complete sequence
          Length = 219723

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 180    catagcatgcattggtgtct 199
              ||||||||||||||||||||
Sbjct: 164270 catagcatgcattggtgtct 164289



to top

>ref|XM_535402.2| PREDICTED: Canis familiaris similar to guanine nucleotide binding
            protein (G protein), alpha inhibiting activity
            polypeptide 1 (LOC478227), mRNA
          Length = 3079

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   aaatttcctccacttgcttg 31
            ||||||||||||||||||||
Sbjct: 2362 aaatttcctccacttgcttg 2381



to top

>gb|AC138400.12| Mus musculus chromosome 14, clone RP23-260C21, complete sequence
          Length = 213423

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   catagcatgcattggtgtct 199
             ||||||||||||||||||||
Sbjct: 44895 catagcatgcattggtgtct 44876



to top

>emb|BX324199.7| Zebrafish DNA sequence from clone DKEYP-7D4 in linkage group 17,
             complete sequence
          Length = 69782

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     acaaaaatggaaatttcctc 21
             ||||||||||||||||||||
Sbjct: 37420 acaaaaatggaaatttcctc 37401



to top

>emb|CR956396.6| Pig DNA sequence from clone CH242-205N12 on chromosome 7, complete
             sequence
          Length = 175108

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 75    acatggaactgaaaacctac 94
             ||||||||||||||||||||
Sbjct: 64639 acatggaactgaaaacctac 64620



to top

>emb|AL591851.12| Mouse DNA sequence from clone RP23-43M4 on chromosome 13 Contains a
             novel gene, an X-linked lymphocyte-regulated 5 (Xlr5)
             pseudogene and the 5' end of the gene for novel protein
             similar to human C6orf32 (KIAA0386, DIFF48), complete
             sequence
          Length = 53867

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     caaaaatggaaatttcctcc 22
             ||||||||||||||||||||
Sbjct: 36123 caaaaatggaaatttcctcc 36142



to top

>gb|BC105419.1| Bos taurus adenylate cyclase-inhibiting G alpha protein, mRNA (cDNA
            clone MGC:128528 IMAGE:7984914), complete cds
          Length = 2825

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   aaatttcctccacttgcttg 31
            ||||||||||||||||||||
Sbjct: 2394 aaatttcctccacttgcttg 2413



to top

>emb|BX004772.17| Zebrafish DNA sequence from clone DKEY-15L1 in linkage group 7,
            complete sequence
          Length = 210545

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    acaaaaatggaaatttcctc 21
            ||||||||||||||||||||
Sbjct: 6404 acaaaaatggaaatttcctc 6423



to top

>emb|AL954383.13| Zebrafish DNA sequence from clone CH211-226M11 in linkage group 17,
              complete sequence
          Length = 206679

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 1      aacaaaaatggaaatttcctccac 24
              |||||||||||||||||| |||||
Sbjct: 177994 aacaaaaatggaaatttcttccac 178017



to top

>gb|AC108670.10| Homo sapiens 3 BAC RP11-218A22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 163157

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 270    tgggttcagcagcatgcctt 289
              ||||||||||||||||||||
Sbjct: 157326 tgggttcagcagcatgcctt 157345



to top

>gb|AC163039.6| Mus musculus BAC clone RP23-188J1 from chromosome 14, complete sequence
          Length = 198538

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   catagcatgcattggtgtct 199
             ||||||||||||||||||||
Sbjct: 20560 catagcatgcattggtgtct 20579



to top

>emb|AL672242.12| Mouse DNA sequence from clone RP23-83P17 on chromosome 17, complete
             sequence
          Length = 222709

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    acatggaactgaaaacctac 94
             ||||||||||||||||||||
Sbjct: 54700 acatggaactgaaaacctac 54719



to top

>emb|X03642.1|BTGIAR Bovine mRNA for alpha-subunit of G(i) protein (Gi=adenylate
            cyclase-inhibiting G-protein)
          Length = 3099

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   aaatttcctccacttgcttg 31
            ||||||||||||||||||||
Sbjct: 2352 aaatttcctccacttgcttg 2371


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,890,896
Number of Sequences: 3902068
Number of extensions: 2890896
Number of successful extensions: 54454
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54422
Number of HSP's gapped (non-prelim): 32
length of query: 336
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 314
effective length of database: 17,147,199,772
effective search space: 5384220728408
effective search space used: 5384220728408
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top