ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl39a07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT018868.1| Zea mays clone EL01N0561F04.d mRNA sequence 48 0.024
2ref|XM_992631.1| PREDICTED: Mus musculus dynein, axonemal, heavy... 42 1.5
3ref|XM_908804.2| PREDICTED: Mus musculus dynein, axonemal, heavy... 42 1.5
4ref|XM_894696.2| PREDICTED: Mus musculus dynein heavy chain doma... 42 1.5
5emb|AL596125.27| Mouse DNA sequence from clone RP23-5O23 on chro... 42 1.5
6gb|DQ369995.1| HIV-1 isolate 02ZAPS015MB1 from South Africa, com... 42 1.5
7gb|AY903244.1| Rattus norvegicus strain BN/Cub dynein axonemal h... 42 1.5
8gb|AY903243.1| Rattus norvegicus strain SHR/OlaIpcv dynein axone... 42 1.5
9gb|AY903242.1| Rattus norvegicus strain WHD dynein axonemal heav... 42 1.5
10ref|XM_220603.3| PREDICTED: Rattus norvegicus dynein-like protei... 42 1.5
11gb|AC146546.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.8
12gb|AC150753.3| Bos taurus BAC CH240-283G19 (Children's Hospital... 40 5.8
13gb|AY322190.1| HIV-1 isolate ML605-3-1997 from Kenya, complete g... 40 5.8
14gb|AY371131.1| HIV-1 isolate 01CM.0074NY from Cameroon gag prote... 40 5.8
15gb|AY371129.1| HIV-1 isolate 02CM.2162SA from Cameroon gag prote... 40 5.8
16gb|AC020606.7| Homo sapiens BAC clone RP11-563O5 from 7, complet... 40 5.8
17gb|AC146090.2| Pan troglodytes BAC clone RP43-47O15 from 7, comp... 40 5.8
18emb|AL590427.15| Human DNA sequence from clone RP11-396N10 on ch... 40 5.8
19gb|AF408626.1| HIV-1 isolate A025 from Argentina, complete genome 40 5.8
20ref|XM_943530.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 5.8
21gb|AY265093.1| HIV-1 isolate 98CM1436 from Cameroon nef protein ... 40 5.8
22gb|AY265064.1| HIV-1 isolate 98CM9835 from Cameroon nef protein ... 40 5.8
23dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.8
24gb|AC157483.2| Pan troglodytes BAC clone CH251-287G22 from chrom... 40 5.8
25gb|AY781128.1| HIV-1 isolate 01UYTRA1020 from Uruguay, complete ... 40 5.8
26gb|AF195771.1|AF195771 Streptomyces albus SsgA (ssgA) gene, comp... 40 5.8
27dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 5.8
28dbj|AP005269.1| Pan troglodytes DNA, chromosome 7 clone:PTB-102E... 40 5.8
29gb|AY899368.1| HIV-1 isolate 04MHI10-1730 from South Korea nef p... 40 5.8
30gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.8
31gb|AY037275.1| HIV-1 isolate ARMA036 from Argentina gag protein ... 40 5.8

>gb|BT018868.1| Zea mays clone EL01N0561F04.d mRNA sequence
          Length = 1943

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 391  agctcctcggagacatacgccagcccctgcatcagcctca 430
            |||||||||||||| || |  |||||||||||||||||||
Sbjct: 1763 agctcctcggagacgtaggagagcccctgcatcagcctca 1724



to top

>ref|XM_992631.1| PREDICTED: Mus musculus dynein, axonemal, heavy chain 2 (Dnahc2),
            mRNA
          Length = 13273

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  tagagcaaccactgctgctga 127
            |||||||||||||||||||||
Sbjct: 2291 tagagcaaccactgctgctga 2271



to top

>ref|XM_908804.2| PREDICTED: Mus musculus dynein, axonemal, heavy chain 2 (Dnahc2),
            mRNA
          Length = 13771

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  tagagcaaccactgctgctga 127
            |||||||||||||||||||||
Sbjct: 2774 tagagcaaccactgctgctga 2754



to top

>ref|XM_894696.2| PREDICTED: Mus musculus dynein heavy chain domain 3, transcript
            variant 2 (Dnhd3), mRNA
          Length = 13704

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  tagagcaaccactgctgctga 127
            |||||||||||||||||||||
Sbjct: 2707 tagagcaaccactgctgctga 2687



to top

>emb|AL596125.27| Mouse DNA sequence from clone RP23-5O23 on chromosome 11 Contains the
              Chd3 gene for chromodomain helicase DNA binding protein 3,
              five novel genes, the 3' end of the gene for a novel
              protein similar to dynein and four CpG islands, complete
              sequence
          Length = 165212

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    tagagcaaccactgctgctga 127
              |||||||||||||||||||||
Sbjct: 155319 tagagcaaccactgctgctga 155339



to top

>gb|DQ369995.1| HIV-1 isolate 02ZAPS015MB1 from South Africa, complete genome
          Length = 9028

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 297  ccttcctcttgtgcttccaac 317
            |||||||||||||||||||||
Sbjct: 8396 ccttcctcttgtgcttccaac 8376



to top

>gb|AY903244.1| Rattus norvegicus strain BN/Cub dynein axonemal heavy chain-like
            protein mRNA, partial cds
          Length = 11994

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  tagagcaaccactgctgctga 127
            |||||||||||||||||||||
Sbjct: 1085 tagagcaaccactgctgctga 1065



to top

>gb|AY903243.1| Rattus norvegicus strain SHR/OlaIpcv dynein axonemal heavy chain-like
            protein mRNA, partial cds
          Length = 11994

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  tagagcaaccactgctgctga 127
            |||||||||||||||||||||
Sbjct: 1085 tagagcaaccactgctgctga 1065



to top

>gb|AY903242.1| Rattus norvegicus strain WHD dynein axonemal heavy chain-like protein
            mRNA, partial cds
          Length = 11994

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  tagagcaaccactgctgctga 127
            |||||||||||||||||||||
Sbjct: 1085 tagagcaaccactgctgctga 1065



to top

>ref|XM_220603.3| PREDICTED: Rattus norvegicus dynein-like protein 2 (DLP2), mRNA
          Length = 14742

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  tagagcaaccactgctgctga 127
            |||||||||||||||||||||
Sbjct: 3512 tagagcaaccactgctgctga 3492



to top

>gb|AC146546.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0062M03 map near S6115, complete sequence
          Length = 138223

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   aaagcatagctcatgtacac 246
             ||||||||||||||||||||
Sbjct: 64929 aaagcatagctcatgtacac 64948



to top

>gb|AC150753.3| Bos taurus  BAC CH240-283G19 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 181464

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 91    ggagcccacaacactctaga 110
             ||||||||||||||||||||
Sbjct: 42827 ggagcccacaacactctaga 42846



to top

>gb|AY322190.1| HIV-1 isolate ML605-3-1997 from Kenya, complete genome
          Length = 9164

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  cttcctcttgtgcttccaac 317
            ||||||||||||||||||||
Sbjct: 8511 cttcctcttgtgcttccaac 8492



to top

>gb|AY371131.1| HIV-1 isolate 01CM.0074NY from Cameroon gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8405

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 296  cccttcctcttgtgcttcca 315
            ||||||||||||||||||||
Sbjct: 8203 cccttcctcttgtgcttcca 8184



to top

>gb|AY371129.1| HIV-1 isolate 02CM.2162SA from Cameroon gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), and envelope glycoprotein (env) genes,
            complete cds; and nef protein (nef) gene, partial cds
          Length = 8440

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  cttcctcttgtgcttccaac 317
            ||||||||||||||||||||
Sbjct: 8236 cttcctcttgtgcttccaac 8217



to top

>gb|AC020606.7| Homo sapiens BAC clone RP11-563O5 from 7, complete sequence
          Length = 151822

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 26     tttttcccatggcattcagagaga 49
              |||||||| |||||||||||||||
Sbjct: 112778 tttttcccctggcattcagagaga 112801



to top

>gb|AC146090.2| Pan troglodytes BAC clone RP43-47O15 from 7, complete sequence
          Length = 189400

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 26    tttttcccatggcattcagagaga 49
             |||||||| |||||||||||||||
Sbjct: 94012 tttttcccctggcattcagagaga 93989



to top

>emb|AL590427.15| Human DNA sequence from clone RP11-396N10 on chromosome 1 Contains
            the 5' end of the NTNG1 gene for netrin G1 and a CpG
            island, complete sequence
          Length = 160135

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 350  ggtcctcggggtcctctccc 369
            ||||||||||||||||||||
Sbjct: 8729 ggtcctcggggtcctctccc 8748



to top

>gb|AF408626.1| HIV-1 isolate A025 from Argentina, complete genome
          Length = 8937

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 296  cccttcctcttgtgcttcca 315
            ||||||||||||||||||||
Sbjct: 8372 cccttcctcttgtgcttcca 8353



to top

>ref|XM_943530.1| PREDICTED: Homo sapiens hypothetical protein LOC648974 (LOC648974),
           mRNA
          Length = 1149

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 ggtcctcggggtcctctccc 369
           ||||||||||||||||||||
Sbjct: 135 ggtcctcggggtcctctccc 116



to top

>gb|AY265093.1| HIV-1 isolate 98CM1436 from Cameroon nef protein (nef) gene,
           complete cds
          Length = 621

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 cttcctcttgtgcttccaac 317
           ||||||||||||||||||||
Sbjct: 190 cttcctcttgtgcttccaac 171



to top

>gb|AY265064.1| HIV-1 isolate 98CM9835 from Cameroon nef protein (nef) gene,
           complete cds
          Length = 639

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccttcctcttgtgcttcca 315
           ||||||||||||||||||||
Sbjct: 207 cccttcctcttgtgcttcca 188



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 227      aaagcatagctcatgtacac 246
                ||||||||||||||||||||
Sbjct: 12208253 aaagcatagctcatgtacac 12208272



to top

>gb|AC157483.2| Pan troglodytes BAC clone CH251-287G22 from chromosome unknown,
             complete sequence
          Length = 163028

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 26    tttttcccatggcattcagagaga 49
             |||||||| |||||||||||||||
Sbjct: 94022 tttttcccctggcattcagagaga 93999



to top

>gb|AY781128.1| HIV-1 isolate 01UYTRA1020 from Uruguay, complete genome
          Length = 8801

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 296  cccttcctcttgtgcttcca 315
            ||||||||||||||||||||
Sbjct: 8186 cccttcctcttgtgcttcca 8167



to top

>gb|AF195771.1|AF195771 Streptomyces albus SsgA (ssgA) gene, complete cds
          Length = 566

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 385 aaggcgagctcctcggagac 404
           ||||||||||||||||||||
Sbjct: 57  aaggcgagctcctcggagac 38



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 328     tgcagctcgccgacgcacca 347
               ||||||||||||||||||||
Sbjct: 1167414 tgcagctcgccgacgcacca 1167395



to top

>dbj|AP005269.1| Pan troglodytes DNA, chromosome 7 clone:PTB-102E09, complete sequence
          Length = 172438

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 26    tttttcccatggcattcagagaga 49
             |||||||| |||||||||||||||
Sbjct: 12943 tttttcccctggcattcagagaga 12920



to top

>gb|AY899368.1| HIV-1 isolate 04MHI10-1730 from South Korea nef protein (nef) gene,
           complete cds
          Length = 663

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 cttcctcttgtgcttccaac 317
           ||||||||||||||||||||
Sbjct: 190 cttcctcttgtgcttccaac 171



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 227      aaagcatagctcatgtacac 246
                ||||||||||||||||||||
Sbjct: 12287560 aaagcatagctcatgtacac 12287579



to top

>gb|AY037275.1| HIV-1 isolate ARMA036 from Argentina gag protein (gag) and pol
            protein (pol) genes, partial cds; vif protein (vif), vpr
            protein (vpr), tat protein (tat), rev protein (rev), vpu
            protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds; and long terminal
            repeat, complete sequence
          Length = 8675

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  cttcctcttgtgcttccaac 317
            ||||||||||||||||||||
Sbjct: 8244 cttcctcttgtgcttccaac 8225


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,480,208
Number of Sequences: 3902068
Number of extensions: 3480208
Number of successful extensions: 71373
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71271
Number of HSP's gapped (non-prelim): 102
length of query: 430
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 408
effective length of database: 17,147,199,772
effective search space: 6996057506976
effective search space used: 6996057506976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top