ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl38h12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC153851.27| Mus musculus 6 BAC RP23-61N4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 217854 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 156 atcaggtaggtaggtaggtaggt 178 ||||||||||||||||||||||| Sbjct: 140380 atcaggtaggtaggtaggtaggt 140358 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 140373 aggtaggtaggtaggtaggt 140354 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 140369 aggtaggtaggtaggtaggt 140350 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 140365 aggtaggtaggtaggtaggt 140346 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 140361 aggtaggtaggtaggtaggt 140342
>gb|AE000663.1|MMAE000663 Mus musculus TCR beta locus from bases 1 to 250611 (section 1 of 3) of the complete sequence Length = 250611 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 156 atcaggtaggtaggtaggtaggt 178 ||||||||||||||||||||||| Sbjct: 203175 atcaggtaggtaggtaggtaggt 203153 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 203168 aggtaggtaggtaggtaggt 203149 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 203164 aggtaggtaggtaggtaggt 203145 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 203160 aggtaggtaggtaggtaggt 203141 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 203156 aggtaggtaggtaggtaggt 203137
>gb|AC125228.4| Mus musculus BAC clone RP23-45H9 from chromosome 6, complete sequence Length = 261600 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 156 atcaggtaggtaggtaggtaggt 178 ||||||||||||||||||||||| Sbjct: 18742 atcaggtaggtaggtaggtaggt 18720 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18735 aggtaggtaggtaggtaggt 18716 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18731 aggtaggtaggtaggtaggt 18712 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18727 aggtaggtaggtaggtaggt 18708 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18723 aggtaggtaggtaggtaggt 18704
>emb|AL031768.9|HS136B1 Human DNA sequence from clone RP1-136B1 on chromosome 6p24.1-25.3, complete sequence Length = 96614 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 156 atcaggtaggtaggtaggtaggt 178 ||||||||||||||||||||||| Sbjct: 16144 atcaggtaggtaggtaggtaggt 16122
>gb|AC010582.6|AC010582 Homo sapiens chromosome 14 clone CTD-2547F10, complete sequence Length = 191549 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 156 atcaggtaggtaggtaggtaggt 178 ||||||||||||||||||||||| Sbjct: 85837 atcaggtaggtaggtaggtaggt 85815 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85830 aggtaggtaggtaggtaggt 85811 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85826 aggtaggtaggtaggtaggt 85807 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85822 aggtaggtaggtaggtaggt 85803 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85818 aggtaggtaggtaggtaggt 85799 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85814 aggtaggtaggtaggtaggt 85795 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85810 aggtaggtaggtaggtaggt 85791 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85806 aggtaggtaggtaggtaggt 85787 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85802 aggtaggtaggtaggtaggt 85783
>emb|AL136040.5|CNS01DVV Human chromosome 14 DNA sequence BAC C-2506P8 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 199420 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Plus Query: 156 atcaggtaggtaggtaggtaggt 178 ||||||||||||||||||||||| Sbjct: 114201 atcaggtaggtaggtaggtaggt 114223 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114236 aggtaggtaggtaggtaggt 114255 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114232 aggtaggtaggtaggtaggt 114251 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114228 aggtaggtaggtaggtaggt 114247 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114224 aggtaggtaggtaggtaggt 114243 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114220 aggtaggtaggtaggtaggt 114239 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114216 aggtaggtaggtaggtaggt 114235 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114212 aggtaggtaggtaggtaggt 114231 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 114208 aggtaggtaggtaggtaggt 114227
>gb|AC148934.2| Pan troglodytes BAC clone CH251-557M20 from Y, complete sequence Length = 169254 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 78747 tcaggtaggtaggtaggtaggt 78768
>gb|AC044864.6| Mus musculus chromosome 3, clone RP23-168E14, complete sequence Length = 224119 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 14643 tcaggtaggtaggtaggtaggt 14664 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 14661 aggtaggtaggtaggtaggt 14680 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 14657 aggtaggtaggtaggtaggt 14676 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 14653 aggtaggtaggtaggtaggt 14672 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 14649 aggtaggtaggtaggtaggt 14668
>gb|AC024849.2| Caenorhabditis elegans cosmid Y67D8B, complete sequence Length = 34029 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 6743 tcaggtaggtaggtaggtaggt 6764 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 7046 caggtaggtaggtaggtaggt 7066 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 7051 aggtaggtaggtaggtaggt 7070 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6867 aggtaggtaggtaggtaggt 6886 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6844 aggtaggtaggtaggtaggt 6863 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6840 aggtaggtaggtaggtaggt 6859 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6761 aggtaggtaggtaggtaggt 6780 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6757 aggtaggtaggtaggtaggt 6776 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6753 aggtaggtaggtaggtaggt 6772 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6749 aggtaggtaggtaggtaggt 6768 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6646 aggtaggtaggtaggtaggt 6665 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6642 aggtaggtaggtaggtaggt 6661 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6638 aggtaggtaggtaggtaggt 6657 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6634 aggtaggtaggtaggtaggt 6653 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6630 aggtaggtaggtaggtaggt 6649 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6626 aggtaggtaggtaggtaggt 6645 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6622 aggtaggtaggtaggtaggt 6641 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6618 aggtaggtaggtaggtaggt 6637 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6614 aggtaggtaggtaggtaggt 6633 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6610 aggtaggtaggtaggtaggt 6629 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6606 aggtaggtaggtaggtaggt 6625
>gb|AC137525.3| Mus musculus BAC clone RP23-68H24 from chromosome 3, complete sequence Length = 203159 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 162134 tcaggtaggtaggtaggtaggt 162155 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 162148 aggtaggtaggtaggtaggt 162167 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 162144 aggtaggtaggtaggtaggt 162163 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 162140 aggtaggtaggtaggtaggt 162159
>gb|AC147151.2| Pan troglodytes BAC clone CH251-205A10 from Y, complete sequence Length = 174629 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 138453 tcaggtaggtaggtaggtaggt 138474
>gb|AC113285.9| Mus musculus chromosome 5, clone RP23-407I6, complete sequence Length = 283052 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 53143 tcaggtaggtaggtaggtaggt 53164 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 52928 aggtaggtaggtaggtaggtt 52948 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 52640 aggtaggtaggtaggtaggtt 52660 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 52333 aggtaggtaggtaggtaggtt 52353 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 52304 caggtaggtaggtaggtaggt 52324 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53209 aggtaggtaggtaggtaggt 53228 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53205 aggtaggtaggtaggtaggt 53224 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53201 aggtaggtaggtaggtaggt 53220 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53197 aggtaggtaggtaggtaggt 53216 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53193 aggtaggtaggtaggtaggt 53212 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53124 aggtaggtaggtaggtaggt 53143 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53120 aggtaggtaggtaggtaggt 53139 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53116 aggtaggtaggtaggtaggt 53135 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53112 aggtaggtaggtaggtaggt 53131 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53108 aggtaggtaggtaggtaggt 53127 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53060 aggtaggtaggtaggtaggt 53079 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53056 aggtaggtaggtaggtaggt 53075 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53052 aggtaggtaggtaggtaggt 53071 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53048 aggtaggtaggtaggtaggt 53067 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53044 aggtaggtaggtaggtaggt 53063 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53040 aggtaggtaggtaggtaggt 53059 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 53000 aggtaggtaggtaggtaggt 53019 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52964 aggtaggtaggtaggtaggt 52983 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52960 aggtaggtaggtaggtaggt 52979 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52924 aggtaggtaggtaggtaggt 52943 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52920 aggtaggtaggtaggtaggt 52939 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52916 aggtaggtaggtaggtaggt 52935 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52912 aggtaggtaggtaggtaggt 52931 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52840 aggtaggtaggtaggtaggt 52859 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52836 aggtaggtaggtaggtaggt 52855 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52832 aggtaggtaggtaggtaggt 52851 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52828 aggtaggtaggtaggtaggt 52847 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52824 aggtaggtaggtaggtaggt 52843 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52776 aggtaggtaggtaggtaggt 52795 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52772 aggtaggtaggtaggtaggt 52791 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52768 aggtaggtaggtaggtaggt 52787 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52764 aggtaggtaggtaggtaggt 52783 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52760 aggtaggtaggtaggtaggt 52779 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52756 aggtaggtaggtaggtaggt 52775 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52716 aggtaggtaggtaggtaggt 52735 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52680 aggtaggtaggtaggtaggt 52699 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52676 aggtaggtaggtaggtaggt 52695 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52672 aggtaggtaggtaggtaggt 52691 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52636 aggtaggtaggtaggtaggt 52655 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52505 aggtaggtaggtaggtaggt 52524 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52501 aggtaggtaggtaggtaggt 52520 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52497 aggtaggtaggtaggtaggt 52516 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52449 aggtaggtaggtaggtaggt 52468 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52445 aggtaggtaggtaggtaggt 52464 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52441 aggtaggtaggtaggtaggt 52460 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52437 aggtaggtaggtaggtaggt 52456 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52413 aggtaggtaggtaggtaggt 52432 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52381 aggtaggtaggtaggtaggt 52400 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52377 aggtaggtaggtaggtaggt 52396 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52373 aggtaggtaggtaggtaggt 52392 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52369 aggtaggtaggtaggtaggt 52388 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52365 aggtaggtaggtaggtaggt 52384 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52329 aggtaggtaggtaggtaggt 52348 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52325 aggtaggtaggtaggtaggt 52344 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52321 aggtaggtaggtaggtaggt 52340 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52317 aggtaggtaggtaggtaggt 52336 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52313 aggtaggtaggtaggtaggt 52332 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 52309 aggtaggtaggtaggtaggt 52328
>gb|AC131742.2| Mus musculus BAC clone RP23-67I3 from chromosome 1, complete sequence Length = 196557 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 51487 tcaggtaggtaggtaggtaggt 51508
>gb|AC140788.4| Mus musculus BAC clone RP23-452K24 from chromosome 2, complete sequence Length = 181527 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 41485 tcaggtaggtaggtaggtaggt 41506 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41763 aggtaggtaggtaggtaggt 41782 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41759 aggtaggtaggtaggtaggt 41778 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41755 aggtaggtaggtaggtaggt 41774 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41751 aggtaggtaggtaggtaggt 41770 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41747 aggtaggtaggtaggtaggt 41766 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41743 aggtaggtaggtaggtaggt 41762 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41615 aggtaggtaggtaggtaggt 41634 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41611 aggtaggtaggtaggtaggt 41630 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41607 aggtaggtaggtaggtaggt 41626 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41603 aggtaggtaggtaggtaggt 41622 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41599 aggtaggtaggtaggtaggt 41618 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41595 aggtaggtaggtaggtaggt 41614 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 ggtaggtaggtaggtaggtt 179 |||||||||||||||||||| Sbjct: 41540 ggtaggtaggtaggtaggtt 41559 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41499 aggtaggtaggtaggtaggt 41518 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41495 aggtaggtaggtaggtaggt 41514 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41491 aggtaggtaggtaggtaggt 41510 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41391 aggtaggtaggtaggtaggt 41410 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41387 aggtaggtaggtaggtaggt 41406 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41383 aggtaggtaggtaggtaggt 41402 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41379 aggtaggtaggtaggtaggt 41398 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41375 aggtaggtaggtaggtaggt 41394 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41371 aggtaggtaggtaggtaggt 41390
>gb|AC116051.4| Mus musculus BAC clone RP23-4L11 from 3, complete sequence Length = 224674 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 71781 tcaggtaggtaggtaggtaggt 71802 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 71795 aggtaggtaggtaggtaggt 71814 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 71791 aggtaggtaggtaggtaggt 71810 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 71787 aggtaggtaggtaggtaggt 71806
>gb|AC154575.2| Mus musculus BAC clone RP23-248E1 from chromosome 14, complete sequence Length = 210912 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 106366 tcaggtaggtaggtaggtaggt 106345
>gb|AC151605.2| Emiliania huxleyi clone JGIACCU-13A3, complete sequence Length = 36153 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 32290 tcaggtaggtaggtaggtaggt 32269 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 32284 aggtaggtaggtaggtaggt 32265 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18475 aggtaggtaggtaggtaggt 18456 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18471 aggtaggtaggtaggtaggt 18452 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18467 aggtaggtaggtaggtaggt 18448 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 18463 aggtaggtaggtaggtaggt 18444
>gb|AC044781.12| Homo sapiens chromosome 10 clone RP11-142M10, complete sequence Length = 177448 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 96399 tcaggtaggtaggtaggtaggt 96378
>dbj|BS000616.1| Pan troglodytes chromosome Y clone:PTB-085B05, complete sequences Length = 74459 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 74282 tcaggtaggtaggtaggtaggt 74261
>dbj|BS000581.1| Pan troglodytes chromosome Y clone:PTB-115D04, complete sequence Length = 190533 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 32856 tcaggtaggtaggtaggtaggt 32835
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 21347092 tcaggtaggtaggtaggtaggt 21347113 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22778392 aggtaggtaggtaggtaggt 22778411 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22124136 aggtaggtaggtaggtaggt 22124117 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22124132 aggtaggtaggtaggtaggt 22124113 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21464694 aggtaggtaggtaggtaggt 21464713 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21464690 aggtaggtaggtaggtaggt 21464709
>gb|AC104561.3| Homo sapiens chromosome 8, clone CTC-756D1, complete sequence Length = 155366 Score = 44.1 bits (22), Expect = 0.31 Identities = 31/34 (91%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggttcggaggcccgcag 192 |||||||||||||||||||| ||||||| |||| Sbjct: 2577 aggtaggtaggtaggtaggtctggaggccagcag 2610 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2573 aggtaggtaggtaggtaggt 2592 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2569 aggtaggtaggtaggtaggt 2588 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2565 aggtaggtaggtaggtaggt 2584 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2561 aggtaggtaggtaggtaggt 2580 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2557 aggtaggtaggtaggtaggt 2576
>gb|AC110076.4| Homo sapiens BAC clone RP11-309M5 from 4, complete sequence Length = 105211 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggtt 179 |||||||||||||||||||||| Sbjct: 69159 caggtaggtaggtaggtaggtt 69138
>gb|AC051642.5| Homo sapiens chromosome 8, clone RP11-583M2, complete sequence Length = 174445 Score = 44.1 bits (22), Expect = 0.31 Identities = 31/34 (91%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggttcggaggcccgcag 192 |||||||||||||||||||| ||||||| |||| Sbjct: 159022 aggtaggtaggtaggtaggtctggaggccagcag 159055 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 159018 aggtaggtaggtaggtaggt 159037 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 159014 aggtaggtaggtaggtaggt 159033 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 159010 aggtaggtaggtaggtaggt 159029 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 159006 aggtaggtaggtaggtaggt 159025 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 159002 aggtaggtaggtaggtaggt 159021 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 158998 aggtaggtaggtaggtaggt 159017 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 158994 aggtaggtaggtaggtaggt 159013
>emb|BX248389.8| Zebrafish DNA sequence from clone CH211-236C4 in linkage group 7, complete sequence Length = 134182 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 106335 tcaggtaggtaggtaggtaggt 106356
>gb|AC154811.2| Mus musculus BAC clone RP24-531D17 from chromosome 14, complete sequence Length = 167122 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggttc 180 |||||||||||||||||||||| Sbjct: 101971 aggtaggtaggtaggtaggttc 101992 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 101967 aggtaggtaggtaggtaggt 101986 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 101963 aggtaggtaggtaggtaggt 101982 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 101959 aggtaggtaggtaggtaggt 101978 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 101955 aggtaggtaggtaggtaggt 101974 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 101951 aggtaggtaggtaggtaggt 101970 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 101947 aggtaggtaggtaggtaggt 101966
>gb|AC011749.2|AC011749 Homo sapiens BAC clone RP11-455E3 from Y, complete sequence Length = 205053 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 23456 tcaggtaggtaggtaggtaggt 23477 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23462 aggtaggtaggtaggtaggt 23481
>emb|AL929262.22| Mouse DNA sequence from clone RP23-452K24 on chromosome 2, complete sequence Length = 145652 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 5719 tcaggtaggtaggtaggtaggt 5740 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5997 aggtaggtaggtaggtaggt 6016 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5993 aggtaggtaggtaggtaggt 6012 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5989 aggtaggtaggtaggtaggt 6008 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5985 aggtaggtaggtaggtaggt 6004 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5981 aggtaggtaggtaggtaggt 6000 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5977 aggtaggtaggtaggtaggt 5996 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5849 aggtaggtaggtaggtaggt 5868 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5845 aggtaggtaggtaggtaggt 5864 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5841 aggtaggtaggtaggtaggt 5860 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5837 aggtaggtaggtaggtaggt 5856 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5833 aggtaggtaggtaggtaggt 5852 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5829 aggtaggtaggtaggtaggt 5848 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 ggtaggtaggtaggtaggtt 179 |||||||||||||||||||| Sbjct: 5774 ggtaggtaggtaggtaggtt 5793 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5733 aggtaggtaggtaggtaggt 5752 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5729 aggtaggtaggtaggtaggt 5748 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5725 aggtaggtaggtaggtaggt 5744 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5625 aggtaggtaggtaggtaggt 5644 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5621 aggtaggtaggtaggtaggt 5640 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5617 aggtaggtaggtaggtaggt 5636 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5613 aggtaggtaggtaggtaggt 5632 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5609 aggtaggtaggtaggtaggt 5628 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5605 aggtaggtaggtaggtaggt 5624
>emb|BX649226.1| Mouse DNA sequence from clone RP23-105O21 on chromosome 2, complete sequence Length = 81271 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 64418 tcaggtaggtaggtaggtaggt 64397 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 64412 aggtaggtaggtaggtaggt 64393 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 64408 aggtaggtaggtaggtaggt 64389
>dbj|AK069215.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023010M03, full insert sequence Length = 1856 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggttc 180 |||||||||||||||||||||| Sbjct: 161 aggtaggtaggtaggtaggttc 182
>gb|AF028783.1|AF028783 Hypocrea jecorina proteasome regulatory subunit 12 (prs12) gene, complete cds Length = 2256 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 63 tcaggtaggtaggtaggtaggt 84
>emb|AL606932.10| Mouse DNA sequence from clone RP23-247I20 on chromosome 4, complete sequence Length = 188633 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 62620 tcaggtaggtaggtaggtaggt 62599 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 62606 aggtaggtaggtaggtaggtt 62586 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62614 aggtaggtaggtaggtaggt 62595 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62610 aggtaggtaggtaggtaggt 62591
>emb|AL671671.5| Mouse DNA sequence from clone RP23-419D6 on chromosome 4, complete sequence Length = 102298 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 157 tcaggtaggtaggtaggtaggt 178 |||||||||||||||||||||| Sbjct: 95713 tcaggtaggtaggtaggtaggt 95734
>gb|AC129582.10| Mus musculus chromosome 5, clone RP24-485O24, complete sequence Length = 184794 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 29068 caggtaggtaggtaggtaggt 29048 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 29063 aggtaggtaggtaggtaggt 29044 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27486 aggtaggtaggtaggtaggt 27467 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27482 aggtaggtaggtaggtaggt 27463 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27478 aggtaggtaggtaggtaggt 27459 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27474 aggtaggtaggtaggtaggt 27455 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27470 aggtaggtaggtaggtaggt 27451
>gb|AC166114.5| Mus musculus BAC clone RP23-63J20 from chromosome 16, complete sequence Length = 207146 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 152591 caggtaggtaggtaggtaggt 152571
>gb|AC024817.1| Caenorhabditis elegans cosmid Y54G2A, complete sequence Length = 286680 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 209320 caggtaggtaggtaggtaggt 209340 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 110535 aggtaggtaggtaggtaggtt 110515 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 110210 caggtaggtaggtaggtaggt 110190 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 209329 aggtaggtaggtaggtaggt 209348 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 209325 aggtaggtaggtaggtaggt 209344 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 208679 aggtaggtaggtaggtaggt 208660 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 208349 aggtaggtaggtaggtaggt 208330 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 208345 aggtaggtaggtaggtaggt 208326 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 206290 aggtaggtaggtaggtaggt 206309 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 190001 aggtaggtaggtaggtaggt 189982 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189977 aggtaggtaggtaggtaggt 189958 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189973 aggtaggtaggtaggtaggt 189954 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189969 aggtaggtaggtaggtaggt 189950 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189965 aggtaggtaggtaggtaggt 189946 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189961 aggtaggtaggtaggtaggt 189942 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189957 aggtaggtaggtaggtaggt 189938 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189953 aggtaggtaggtaggtaggt 189934 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189949 aggtaggtaggtaggtaggt 189930 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189945 aggtaggtaggtaggtaggt 189926 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189941 aggtaggtaggtaggtaggt 189922 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189937 aggtaggtaggtaggtaggt 189918 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189933 aggtaggtaggtaggtaggt 189914 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 189929 aggtaggtaggtaggtaggt 189910 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 110539 aggtaggtaggtaggtaggt 110520 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 110360 aggtaggtaggtaggtaggt 110341 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 110356 aggtaggtaggtaggtaggt 110337 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 110352 aggtaggtaggtaggtaggt 110333 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 110205 aggtaggtaggtaggtaggt 110186
>gb|AC151369.4| Aotus nancymaae clone CH258-279B4, complete sequence Length = 196485 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 89685 caggtaggtaggtaggtaggt 89705
>gb|AC121261.9| Mus musculus chromosome 7, clone RP24-69L13, complete sequence Length = 163319 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 74902 caggtaggtaggtaggtaggt 74882 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 74897 aggtaggtaggtaggtaggt 74878 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 74893 aggtaggtaggtaggtaggt 74874 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 74889 aggtaggtaggtaggtaggt 74870 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 74885 aggtaggtaggtaggtaggt 74866 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 74881 aggtaggtaggtaggtaggt 74862
>gb|AC169382.2| Mus musculus chromosome 1, clone wi1-1860G10, complete sequence Length = 40385 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 27996 caggtaggtaggtaggtaggt 28016 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28005 aggtaggtaggtaggtaggt 28024 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28001 aggtaggtaggtaggtaggt 28020
>gb|AC159412.1| Trypanosoma brucei chromosome 7 clone RPCI93-21H15, complete sequence Length = 159636 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 50650 aggtaggtaggtaggtaggtt 50670 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50646 aggtaggtaggtaggtaggt 50665
>gb|AY753064.1| Penaeus monodon clone t602 microsatellite sequence Length = 642 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 606 caggtaggtaggtaggtaggt 586 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 601 aggtaggtaggtaggtaggt 582 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 597 aggtaggtaggtaggtaggt 578 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 593 aggtaggtaggtaggtaggt 574 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 589 aggtaggtaggtaggtaggt 570 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 585 aggtaggtaggtaggtaggt 566 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 581 aggtaggtaggtaggtaggt 562 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 577 aggtaggtaggtaggtaggt 558 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 553 aggtaggtaggtaggtaggt 534 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 549 aggtaggtaggtaggtaggt 530 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 545 aggtaggtaggtaggtaggt 526 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 541 aggtaggtaggtaggtaggt 522 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 537 aggtaggtaggtaggtaggt 518 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 533 aggtaggtaggtaggtaggt 514
>ref|NM_001012324.1| Mus musculus extracellular matrix protein 2, female organ and adipocyte specific (Ecm2), mRNA Length = 3627 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 3311 caggtaggtaggtaggtaggt 3291 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3306 aggtaggtaggtaggtaggt 3287 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3302 aggtaggtaggtaggtaggt 3283 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3298 aggtaggtaggtaggtaggt 3279 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3294 aggtaggtaggtaggtaggt 3275
>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence Length = 2205233 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 2055948 aggtaggtaggtaggtaggtt 2055928 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2055952 aggtaggtaggtaggtaggt 2055933
>gb|AC004235.1| Homo sapiens chromosome 16, cosmid clone 432A1 (LANL), complete sequence Length = 33311 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 15992 aggtaggtaggtaggtaggtt 15972 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 15996 aggtaggtaggtaggtaggt 15977
>gb|AC159702.1| Trypanosoma brucei chromosome 7 clone RPCI93-30D13, complete sequence Length = 171752 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 149267 aggtaggtaggtaggtaggtt 149287 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 149263 aggtaggtaggtaggtaggt 149282
>gb|AC102075.7| Mus musculus chromosome 5, clone RP23-389F20, complete sequence Length = 208311 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 167551 caggtaggtaggtaggtaggt 167571 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 167564 aggtaggtaggtaggtaggt 167583 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 167560 aggtaggtaggtaggtaggt 167579 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 167556 aggtaggtaggtaggtaggt 167575
>gb|AC162892.7| Mus musculus chromosome 5, clone RP23-257D19, complete sequence Length = 155647 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 103509 caggtaggtaggtaggtaggt 103489 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103504 aggtaggtaggtaggtaggt 103485 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103500 aggtaggtaggtaggtaggt 103481 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103496 aggtaggtaggtaggtaggt 103477 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103492 aggtaggtaggtaggtaggt 103473
>gb|AC105076.25| Mus musculus chromosome 3, clone RP23-258P2, complete sequence Length = 193458 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 175100 caggtaggtaggtaggtaggt 175120 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 175121 aggtaggtaggtaggtaggt 175140 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 175117 aggtaggtaggtaggtaggt 175136 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 175113 aggtaggtaggtaggtaggt 175132 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 175109 aggtaggtaggtaggtaggt 175128 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 175105 aggtaggtaggtaggtaggt 175124 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 94915 aggtaggtaggtaggtaggt 94934
>gb|BC079728.1| Xenopus laevis MGC83534 protein, mRNA (cDNA clone MGC:83534 IMAGE:5078660), complete cds Length = 3029 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 1362 caggtaggtaggtaggtaggt 1342 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 1357 aggtaggtaggtaggtaggt 1338 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 1353 aggtaggtaggtaggtaggt 1334
>gb|AC102594.15| Mus musculus chromosome 5, clone RP23-356G21, complete sequence Length = 189741 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 103245 caggtaggtaggtaggtaggt 103265 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 103109 caggtaggtaggtaggtaggt 103129 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103250 aggtaggtaggtaggtaggt 103269 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103118 aggtaggtaggtaggtaggt 103137 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103114 aggtaggtaggtaggtaggt 103133 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103022 aggtaggtaggtaggtaggt 103041 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103018 aggtaggtaggtaggtaggt 103037 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103014 aggtaggtaggtaggtaggt 103033 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 103010 aggtaggtaggtaggtaggt 103029
>gb|AC150674.4| Bos taurus BAC CH240-443I13 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 194860 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 33 ttattcagaaaatgtattagtttgg 57 |||||||||||||||||| |||||| Sbjct: 169114 ttattcagaaaatgtattggtttgg 169090
>gb|AC009197.9| Drosophila melanogaster clone BACR14M08, complete sequence Length = 170053 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 122171 caggtaggtaggtaggtaggt 122151 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 122166 aggtaggtaggtaggtaggt 122147
>gb|AC010123.9| Drosophila melanogaster clone BACR35O22, complete sequence Length = 160444 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 131082 caggtaggtaggtaggtaggt 131102 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 131087 aggtaggtaggtaggtaggt 131106
>gb|AC129332.6| Mus musculus BAC clone RP23-91I19 from chromosome 9, complete sequence Length = 219117 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 24918 caggtaggtaggtaggtaggt 24898 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24913 aggtaggtaggtaggtaggt 24894
>gb|AC116595.4| Mus musculus BAC clone RP24-127G9 from chromosome 18, complete sequence Length = 158788 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 112755 aggtaggtaggtaggtaggtt 112775 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 112751 aggtaggtaggtaggtaggt 112770
>gb|AC107795.17| Mus musculus chromosome 1, clone RP23-433P9, complete sequence Length = 216501 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 122435 caggtaggtaggtaggtaggt 122415 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 122430 aggtaggtaggtaggtaggt 122411
>gb|AC137981.2| Mus musculus BAC clone RP24-156N24 from chromosome 10, complete sequence Length = 151463 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 27186 caggtaggtaggtaggtaggt 27166 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27181 aggtaggtaggtaggtaggt 27162 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27177 aggtaggtaggtaggtaggt 27158 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27173 aggtaggtaggtaggtaggt 27154 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27169 aggtaggtaggtaggtaggt 27150 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27165 aggtaggtaggtaggtaggt 27146
>gb|AC146106.3| Pan troglodytes BAC clone RP43-5I17 from 7, complete sequence Length = 221821 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 46310 aggtaggtaggtaggtaggtt 46290
>gb|AC135239.3| Mus musculus BAC clone RP23-324D2 from chromosome 3, complete sequence Length = 190178 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 139135 caggtaggtaggtaggtaggt 139115
>gb|AY601851.1| Homo sapiens mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) (MSH2) gene, complete cds Length = 83678 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 20503 aggtaggtaggtaggtaggtt 20483 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 20507 aggtaggtaggtaggtaggt 20488
>gb|AC148206.3| Callicebus moloch clone LB5-384O14, complete sequence Length = 160507 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 41283 caggtaggtaggtaggtaggt 41303 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41296 aggtaggtaggtaggtaggt 41315 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41292 aggtaggtaggtaggtaggt 41311 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 41288 aggtaggtaggtaggtaggt 41307
>gb|AC102050.13| Mus musculus chromosome 8, clone RP23-389O4, complete sequence Length = 203942 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 81839 aggtaggtaggtaggtaggtt 81819
>gb|AC130672.10| Mus musculus chromosome 1, clone RP24-95L18, complete sequence Length = 208480 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 191929 caggtaggtaggtaggtaggt 191909
>gb|AC113201.15| Mus musculus chromosome 6, clone RP23-271G7, complete sequence Length = 205816 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 125923 caggtaggtaggtaggtaggt 125943
>gb|AC111029.8| Mus musculus chromosome 3, clone RP23-235E15, complete sequence Length = 196520 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 182424 caggtaggtaggtaggtaggt 182404 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182419 aggtaggtaggtaggtaggt 182400 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182415 aggtaggtaggtaggtaggt 182396 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182411 aggtaggtaggtaggtaggt 182392 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182407 aggtaggtaggtaggtaggt 182388 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182403 aggtaggtaggtaggtaggt 182384
>gb|AC108798.11| Mus musculus chromosome 5, clone RP23-419N6, complete sequence Length = 211603 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 192460 caggtaggtaggtaggtaggt 192480 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 192473 aggtaggtaggtaggtaggt 192492 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 192469 aggtaggtaggtaggtaggt 192488 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 192465 aggtaggtaggtaggtaggt 192484
>gb|AC025724.3| Caenorhabditis elegans cosmid Y67D8C, complete sequence Length = 103670 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 56615 caggtaggtaggtaggtaggt 56635
>gb|AC099735.47| Mus musculus chromosome 1, clone RP23-218I9, complete sequence Length = 207768 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 200734 aggtaggtaggtaggtaggtt 200714 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 200762 aggtaggtaggtaggtaggt 200743 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 200758 aggtaggtaggtaggtaggt 200739 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 200754 aggtaggtaggtaggtaggt 200735 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 200750 aggtaggtaggtaggtaggt 200731 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 200746 aggtaggtaggtaggtaggt 200727 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 200742 aggtaggtaggtaggtaggt 200723 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 200738 aggtaggtaggtaggtaggt 200719
>gb|AY456695.1| Rattus norvegicus SA protein (Sah) gene, complete cds Length = 26997 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 22818 aggtaggtaggtaggtaggtt 22838 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22814 aggtaggtaggtaggtaggt 22833 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22810 aggtaggtaggtaggtaggt 22829 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22806 aggtaggtaggtaggtaggt 22825 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22802 aggtaggtaggtaggtaggt 22821 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22798 aggtaggtaggtaggtaggt 22817 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22794 aggtaggtaggtaggtaggt 22813 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22790 aggtaggtaggtaggtaggt 22809
>gb|AY455861.1| Rattus norvegicus SAH (Sah) gene, complete cds Length = 32300 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 26849 aggtaggtaggtaggtaggtt 26869 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26845 aggtaggtaggtaggtaggt 26864 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26841 aggtaggtaggtaggtaggt 26860
>gb|AC073273.9| Homo sapiens BAC clone RP11-643A21 from 7, complete sequence Length = 152884 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 127143 aggtaggtaggtaggtaggtt 127123 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 127151 aggtaggtaggtaggtaggt 127132 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 127147 aggtaggtaggtaggtaggt 127128
>gb|AC127340.4| Mus musculus BAC clone RP23-188M2 from chromosome 18, complete sequence Length = 210649 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 19433 aggtaggtaggtaggtaggtt 19453 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19429 aggtaggtaggtaggtaggt 19448 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19425 aggtaggtaggtaggtaggt 19444 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19421 aggtaggtaggtaggtaggt 19440 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19417 aggtaggtaggtaggtaggt 19436 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19413 aggtaggtaggtaggtaggt 19432 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19409 aggtaggtaggtaggtaggt 19428 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19405 aggtaggtaggtaggtaggt 19424
>emb|BX088548.10| Zebrafish DNA sequence from clone CH211-188E4, complete sequence Length = 152713 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 108714 aggtaggtaggtaggtaggtt 108694 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 107207 aggtaggtaggtaggtaggtt 107187 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108722 aggtaggtaggtaggtaggt 108703 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108718 aggtaggtaggtaggtaggt 108699 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108690 aggtaggtaggtaggtaggt 108671 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108686 aggtaggtaggtaggtaggt 108667 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108682 aggtaggtaggtaggtaggt 108663 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108678 aggtaggtaggtaggtaggt 108659 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108674 aggtaggtaggtaggtaggt 108655 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108503 aggtaggtaggtaggtaggt 108484 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108325 aggtaggtaggtaggtaggt 108306
>emb|Z99273.1|CEY45F10C Caenorhabditis elegans YAC Y45F10C, complete sequence Length = 18806 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 2305 caggtaggtaggtaggtaggt 2285 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2300 aggtaggtaggtaggtaggt 2281 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2296 aggtaggtaggtaggtaggt 2277 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2292 aggtaggtaggtaggtaggt 2273 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 2288 aggtaggtaggtaggtaggt 2269
>emb|CT009661.10| Mouse DNA sequence from clone CH29-621D18 on chromosome 17, complete sequence Length = 224982 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 63784 aggtaggtaggtaggtaggtt 63764 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63707 aggtaggtaggtaggtaggt 63688 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63703 aggtaggtaggtaggtaggt 63684 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63699 aggtaggtaggtaggtaggt 63680 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63695 aggtaggtaggtaggtaggt 63676
>emb|CR925784.13| Zebrafish DNA sequence from clone DKEYP-104A3 in linkage group 11, complete sequence Length = 174101 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 78735 aggtaggtaggtaggtaggtt 78715 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 78743 aggtaggtaggtaggtaggt 78724 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 78739 aggtaggtaggtaggtaggt 78720
>gb|AC107664.8| Mus musculus chromosome 17, clone RP23-103F2, complete sequence Length = 208198 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 198768 caggtaggtaggtaggtaggt 198748 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 198638 caggtaggtaggtaggtaggt 198618 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198763 aggtaggtaggtaggtaggt 198744 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198759 aggtaggtaggtaggtaggt 198740 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198755 aggtaggtaggtaggtaggt 198736 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198633 aggtaggtaggtaggtaggt 198614 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198629 aggtaggtaggtaggtaggt 198610 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198625 aggtaggtaggtaggtaggt 198606 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198621 aggtaggtaggtaggtaggt 198602 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198617 aggtaggtaggtaggtaggt 198598 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 198613 aggtaggtaggtaggtaggt 198594
>emb|AL117207.1|CEY60A3A Caenorhabditis elegans YAC Y60A3A, complete sequence Length = 122592 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 28974 caggtaggtaggtaggtaggt 28994 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28979 aggtaggtaggtaggtaggt 28998
>gb|AY444343.1| Hypocrea jecorina strain QM 9414 glucose transporter (hxt1) gene, complete cds Length = 6750 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 3803 caggtaggtaggtaggtaggt 3783 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3798 aggtaggtaggtaggtaggt 3779
>gb|AC124441.5| Mus musculus BAC clone RP24-176L17 from chromosome 18, complete sequence Length = 190119 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 128892 caggtaggtaggtaggtaggt 128872 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 128883 aggtaggtaggtaggtaggtt 128863 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 128887 aggtaggtaggtaggtaggt 128868 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 128859 aggtaggtaggtaggtaggt 128840
>gb|AC125527.3| Mus musculus BAC clone RP24-550H17 from chromosome 1, complete sequence Length = 153191 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 73210 caggtaggtaggtaggtaggt 73230 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 73215 aggtaggtaggtaggtaggt 73234
>gb|AC115290.5| Mus musculus BAC clone RP23-65M10 from chromosome 10, complete sequence Length = 245623 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 35930 caggtaggtaggtaggtaggt 35950 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182613 aggtaggtaggtaggtaggt 182632 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182609 aggtaggtaggtaggtaggt 182628 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182605 aggtaggtaggtaggtaggt 182624 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 182601 aggtaggtaggtaggtaggt 182620 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35951 aggtaggtaggtaggtaggt 35970 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35947 aggtaggtaggtaggtaggt 35966 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35943 aggtaggtaggtaggtaggt 35962 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35939 aggtaggtaggtaggtaggt 35958 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35935 aggtaggtaggtaggtaggt 35954
>gb|AC099511.5| Homo sapiens chromosome 16 clone RP11-293N14, complete sequence Length = 173627 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 38076 caggtaggtaggtaggtaggt 38096
>gb|AC002492.1|HUAC002492 Human Chromosome 16 BAC clone CIT987SK-A-256A9, complete sequence Length = 179245 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 118573 aggtaggtaggtaggtaggtt 118593 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 118569 aggtaggtaggtaggtaggt 118588
>gb|AC092115.2| Homo sapiens chromosome 16 clone CTD-2033A16, complete sequence Length = 136959 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 78426 caggtaggtaggtaggtaggt 78446 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 78431 aggtaggtaggtaggtaggt 78450
>gb|AC123040.4| Mus musculus BAC clone RP24-532L16 from chromosome 8, complete sequence Length = 171193 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 16449 caggtaggtaggtaggtaggt 16469 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16474 aggtaggtaggtaggtaggt 16493 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16470 aggtaggtaggtaggtaggt 16489 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16466 aggtaggtaggtaggtaggt 16485 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16462 aggtaggtaggtaggtaggt 16481 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16458 aggtaggtaggtaggtaggt 16477 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16454 aggtaggtaggtaggtaggt 16473
>gb|AC125399.3| Mus musculus BAC clone RP24-245C15 from chromosome 14, complete sequence Length = 195425 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 136309 caggtaggtaggtaggtaggt 136289 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 136205 caggtaggtaggtaggtaggt 136185 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 136117 caggtaggtaggtaggtaggt 136097 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 136029 caggtaggtaggtaggtaggt 136009 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 135945 caggtaggtaggtaggtaggt 135925 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 136304 aggtaggtaggtaggtaggt 136285 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 136300 aggtaggtaggtaggtaggt 136281 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 136296 aggtaggtaggtaggtaggt 136277 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 136292 aggtaggtaggtaggtaggt 136273
>gb|AC009600.20| Homo sapiens 2 BAC RP11-436K12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 217304 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 25220 aggtaggtaggtaggtaggtt 25200 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 25224 aggtaggtaggtaggtaggt 25205
>gb|AC079456.28| Homo sapiens 12 BAC RP11-206B11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177640 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 83761 caggtaggtaggtaggtaggt 83741 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 83756 aggtaggtaggtaggtaggt 83737
>gb|AC126252.3| Mus musculus BAC clone RP23-480B9 from chromosome 17, complete sequence Length = 172380 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 21887 aggtaggtaggtaggtaggtt 21907 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21976 aggtaggtaggtaggtaggt 21995 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21972 aggtaggtaggtaggtaggt 21991 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21968 aggtaggtaggtaggtaggt 21987 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21964 aggtaggtaggtaggtaggt 21983 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21883 aggtaggtaggtaggtaggt 21902 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21879 aggtaggtaggtaggtaggt 21898 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21875 aggtaggtaggtaggtaggt 21894
>emb|Z81583.1|CET02G6 Caenorhabditis elegans Cosmid T02G6, complete sequence Length = 37420 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 6969 caggtaggtaggtaggtaggt 6949 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6964 aggtaggtaggtaggtaggt 6945
>emb|CR762488.16| Zebrafish DNA sequence from clone DKEY-266J7 in linkage group 18, complete sequence Length = 154489 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 153143 aggtaggtaggtaggtaggtt 153163
>gb|AC127293.3| Mus musculus BAC clone RP23-385B3 from chromosome 18, complete sequence Length = 209455 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 26974 aggtaggtaggtaggtaggtt 26954 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27002 aggtaggtaggtaggtaggt 26983 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26998 aggtaggtaggtaggtaggt 26979 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26994 aggtaggtaggtaggtaggt 26975 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26990 aggtaggtaggtaggtaggt 26971 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26986 aggtaggtaggtaggtaggt 26967 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26982 aggtaggtaggtaggtaggt 26963 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26978 aggtaggtaggtaggtaggt 26959
>gb|AC122916.4| Mus musculus BAC clone RP23-28F1 from 5, complete sequence Length = 231319 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 195334 caggtaggtaggtaggtaggt 195354 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 195363 aggtaggtaggtaggtaggt 195382 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 195359 aggtaggtaggtaggtaggt 195378 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 195355 aggtaggtaggtaggtaggt 195374 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 195351 aggtaggtaggtaggtaggt 195370 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 195347 aggtaggtaggtaggtaggt 195366 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 195343 aggtaggtaggtaggtaggt 195362 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 195339 aggtaggtaggtaggtaggt 195358
>gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, complete sequence Length = 200727 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 22401 caggtaggtaggtaggtaggt 22421 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22418 aggtaggtaggtaggtaggt 22437 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22414 aggtaggtaggtaggtaggt 22433 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22410 aggtaggtaggtaggtaggt 22429 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 22406 aggtaggtaggtaggtaggt 22425
>gb|AC122203.4| Mus musculus BAC clone RP23-69J7 from 5, complete sequence Length = 269047 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 222586 caggtaggtaggtaggtaggt 222566 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 222450 caggtaggtaggtaggtaggt 222430 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 222685 aggtaggtaggtaggtaggt 222666 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 222681 aggtaggtaggtaggtaggt 222662 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 222677 aggtaggtaggtaggtaggt 222658 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 222673 aggtaggtaggtaggtaggt 222654 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 222581 aggtaggtaggtaggtaggt 222562 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 222577 aggtaggtaggtaggtaggt 222558 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 222445 aggtaggtaggtaggtaggt 222426
>gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, complete sequence Length = 219825 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 169547 aggtaggtaggtaggtaggtt 169527 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169657 aggtaggtaggtaggtaggt 169638 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169653 aggtaggtaggtaggtaggt 169634 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169571 aggtaggtaggtaggtaggt 169552 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169567 aggtaggtaggtaggtaggt 169548 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169563 aggtaggtaggtaggtaggt 169544 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169559 aggtaggtaggtaggtaggt 169540 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169555 aggtaggtaggtaggtaggt 169536 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 169551 aggtaggtaggtaggtaggt 169532
>gb|AC098887.4| Mus musculus BAC clone RP23-122N6 from 10, complete sequence Length = 211397 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 8887 caggtaggtaggtaggtaggt 8867 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8882 aggtaggtaggtaggtaggt 8863 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8878 aggtaggtaggtaggtaggt 8859 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8874 aggtaggtaggtaggtaggt 8855 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8870 aggtaggtaggtaggtaggt 8851 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8866 aggtaggtaggtaggtaggt 8847 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8862 aggtaggtaggtaggtaggt 8843 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8858 aggtaggtaggtaggtaggt 8839
>gb|AC121800.2| Mus musculus BAC clone RP23-430F24 from 6, complete sequence Length = 188312 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 148 tactgcgcatcaggtaggtag 168 ||||||||||||||||||||| Sbjct: 3570 tactgcgcatcaggtaggtag 3550
>gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, complete sequence Length = 172114 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 23077 aggtaggtaggtaggtaggtt 23097 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23073 aggtaggtaggtaggtaggt 23092
>gb|AC121768.2| Mus musculus BAC clone RP23-339H16 from 15, complete sequence Length = 199607 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 133252 caggtaggtaggtaggtaggt 133272 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 133265 aggtaggtaggtaggtaggt 133284 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 133261 aggtaggtaggtaggtaggt 133280 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 133257 aggtaggtaggtaggtaggt 133276
>gb|AC099593.6| Mus musculus chromosome 10, clone RP23-447D24, complete sequence Length = 176068 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 145359 caggtaggtaggtaggtaggt 145339 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 145354 aggtaggtaggtaggtaggt 145335 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 145350 aggtaggtaggtaggtaggt 145331 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 145346 aggtaggtaggtaggtaggt 145327
>gb|AC113124.9| Mus musculus chromosome 19, clone RP23-350M1, complete sequence Length = 216547 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 181518 aggtaggtaggtaggtaggtt 181498 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 203011 aggtaggtaggtaggtaggt 202992
>gb|AC108919.7| Mus musculus chromosome 6, clone RP23-52O21, complete sequence Length = 141653 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 87448 caggtaggtaggtaggtaggt 87428 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87443 aggtaggtaggtaggtaggt 87424 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87439 aggtaggtaggtaggtaggt 87420 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87435 aggtaggtaggtaggtaggt 87416 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87431 aggtaggtaggtaggtaggt 87412 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87427 aggtaggtaggtaggtaggt 87408
>gb|AF125954.2| Caenorhabditis elegans cosmid C13B7, complete sequence Length = 23458 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 19488 caggtaggtaggtaggtaggt 19508 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 19348 caggtaggtaggtaggtaggt 19368 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19465 aggtaggtaggtaggtaggt 19484 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19461 aggtaggtaggtaggtaggt 19480 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19457 aggtaggtaggtaggtaggt 19476 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19453 aggtaggtaggtaggtaggt 19472 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19449 aggtaggtaggtaggtaggt 19468 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19445 aggtaggtaggtaggtaggt 19464 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19441 aggtaggtaggtaggtaggt 19460 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19437 aggtaggtaggtaggtaggt 19456 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19433 aggtaggtaggtaggtaggt 19452 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19429 aggtaggtaggtaggtaggt 19448 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19425 aggtaggtaggtaggtaggt 19444 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19421 aggtaggtaggtaggtaggt 19440 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19417 aggtaggtaggtaggtaggt 19436 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19413 aggtaggtaggtaggtaggt 19432 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19409 aggtaggtaggtaggtaggt 19428 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19405 aggtaggtaggtaggtaggt 19424 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19401 aggtaggtaggtaggtaggt 19420 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19397 aggtaggtaggtaggtaggt 19416 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19353 aggtaggtaggtaggtaggt 19372
>gb|AC114403.15| Mus musculus chromosome 1, clone RP23-197H1, complete sequence Length = 221305 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 99785 caggtaggtaggtaggtaggt 99765
>gb|AC157800.9| Mus musculus chromosome 1, clone RP24-286C21, complete sequence Length = 164708 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 144645 caggtaggtaggtaggtaggt 144665 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 144650 aggtaggtaggtaggtaggt 144669
>gb|AC107231.9| Mus musculus chromosome 14, clone RP23-475A2, complete sequence Length = 216217 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 38815 aggtaggtaggtaggtaggtt 38795 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38819 aggtaggtaggtaggtaggt 38800 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38791 aggtaggtaggtaggtaggt 38772 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38787 aggtaggtaggtaggtaggt 38768 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38783 aggtaggtaggtaggtaggt 38764 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38779 aggtaggtaggtaggtaggt 38760 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38775 aggtaggtaggtaggtaggt 38756 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38771 aggtaggtaggtaggtaggt 38752 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38767 aggtaggtaggtaggtaggt 38748 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38711 aggtaggtaggtaggtaggt 38692 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38707 aggtaggtaggtaggtaggt 38688 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 38703 aggtaggtaggtaggtaggt 38684
>gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosome 1, complete sequence Length = 196584 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 185059 caggtaggtaggtaggtaggt 185079 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 185064 aggtaggtaggtaggtaggt 185083
>gb|AC164009.3| Mus musculus chromosome 18, clone RP24-362C21, complete sequence Length = 134903 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 32 tttattcagaaaatgtattag 52 ||||||||||||||||||||| Sbjct: 52791 tttattcagaaaatgtattag 52811
>emb|CR848728.7| Zebrafish DNA sequence from clone CH211-251H16 in linkage group 2, complete sequence Length = 169884 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 29094 caggtaggtaggtaggtaggt 29074 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 29089 aggtaggtaggtaggtaggt 29070
>gb|AC160978.4| Mus musculus BAC clone RP23-426B17 from chromosome 13, complete sequence Length = 197652 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 143706 caggtaggtaggtaggtaggt 143726 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143723 aggtaggtaggtaggtaggt 143742 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143719 aggtaggtaggtaggtaggt 143738 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143715 aggtaggtaggtaggtaggt 143734 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143711 aggtaggtaggtaggtaggt 143730
>gb|BC089559.1| Mus musculus extracellular matrix protein 2, female organ and adipocyte specific, mRNA (cDNA clone MGC:107322 IMAGE:30295705), complete cds Length = 3627 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 3311 caggtaggtaggtaggtaggt 3291 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3306 aggtaggtaggtaggtaggt 3287 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3302 aggtaggtaggtaggtaggt 3283 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3298 aggtaggtaggtaggtaggt 3279 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3294 aggtaggtaggtaggtaggt 3275
>emb|BX936363.13| Zebrafish DNA sequence from clone CH211-112P19 in linkage group 11, complete sequence Length = 184849 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 tcttttgattctgacttatca 284 ||||||||||||||||||||| Sbjct: 90256 tcttttgattctgacttatca 90236
>gb|AC096909.10| Rattus norvegicus 8 BAC CH230-88B13 (Children's Hospital Oakland Research Institute) complete sequence Length = 241078 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 92684 caggtaggtaggtaggtaggt 92704
>emb|CR457452.12| Zebrafish DNA sequence from clone DKEY-52H10 in linkage group 8, complete sequence Length = 232104 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 141100 aggtaggtaggtaggtaggtt 141120 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 35711 caggtaggtaggtaggtaggt 35731 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 141096 aggtaggtaggtaggtaggt 141115 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 141092 aggtaggtaggtaggtaggt 141111
>emb|AL732604.5| Human DNA sequence from clone RP11-27G9 on chromosome X Contains a SET translocation (myeloid leukemia-associated) (SET) pseudogene, complete sequence Length = 166517 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 77810 caggtaggtaggtaggtaggt 77790 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 77805 aggtaggtaggtaggtaggt 77786 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 77801 aggtaggtaggtaggtaggt 77782 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 77797 aggtaggtaggtaggtaggt 77778 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 77793 aggtaggtaggtaggtaggt 77774 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 77789 aggtaggtaggtaggtaggt 77770
>emb|AL591962.15| Human DNA sequence from clone RP11-346O16 on chromosome 6, complete sequence Length = 86881 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 68199 aggtaggtaggtaggtaggtt 68219 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 ggtaggtaggtaggtaggtt 179 |||||||||||||||||||| Sbjct: 68248 ggtaggtaggtaggtaggtt 68267
>emb|AL355476.12| Human DNA sequence from clone RP11-517O1 on chromosome X Contains the 3' end of the STAG2 gene for stromal antigen 2, complete sequence Length = 118234 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 4223 caggtaggtaggtaggtaggt 4243 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4256 aggtaggtaggtaggtaggt 4275 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4252 aggtaggtaggtaggtaggt 4271 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4248 aggtaggtaggtaggtaggt 4267 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4244 aggtaggtaggtaggtaggt 4263 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4240 aggtaggtaggtaggtaggt 4259 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4236 aggtaggtaggtaggtaggt 4255 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4232 aggtaggtaggtaggtaggt 4251 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 4228 aggtaggtaggtaggtaggt 4247
>emb|AL355578.4| Human DNA sequence from clone RP11-29P20 on chromosome 13q31.1-31.3 Contains part of a novel gene and a CpG island, complete sequence Length = 157949 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 21854 caggtaggtaggtaggtaggt 21874 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 21859 aggtaggtaggtaggtaggt 21878
>emb|CR381619.9| Zebrafish DNA sequence from clone DKEY-1O2 in linkage group 5, complete sequence Length = 266753 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 197904 aggtaggtaggtaggtaggtt 197924 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 197900 aggtaggtaggtaggtaggt 197919
>gb|AC161513.5| Mus musculus chromosome 3, clone RP23-238A12, complete sequence Length = 160438 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 107800 caggtaggtaggtaggtaggt 107780 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 107795 aggtaggtaggtaggtaggt 107776 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 107791 aggtaggtaggtaggtaggt 107772 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 107787 aggtaggtaggtaggtaggt 107768
>emb|BX897677.1| Neurospora crassa DNA linkage group VI BAC clone B15B10 Length = 77986 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 162 taggtaggtaggtaggttcggaggc 186 |||||||||||||||||| |||||| Sbjct: 22290 taggtaggtaggtaggttaggaggc 22314
>emb|BX842625.1| Neurospora crassa DNA linkage group I BAC clone B16D18 Length = 76004 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 28393 caggtaggtaggtaggtaggt 28413
>gb|AC100775.3| Homo sapiens chromosome 18, clone CTD-2526M8, complete sequence Length = 175268 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 65880 caggtaggtaggtaggtaggt 65860
>emb|BX005427.19| Zebrafish DNA sequence from clone DKEY-24F17 in linkage group 20 Contains the gene for a novel protein similar to elastase 2, the 3' end of the alas2 gene for aminolevulinate, delta-, synthetase 2, the gene for a novel elastase protein (zgc:637440), two novel genes and two CpG islands, complete sequence Length = 134851 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 81770 aggtaggtaggtaggtaggtt 81750 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 81682 aggtaggtaggtaggtaggtt 81662 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 81774 aggtaggtaggtaggtaggt 81755 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 81702 aggtaggtaggtaggtaggt 81683 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 81698 aggtaggtaggtaggtaggt 81679 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 81694 aggtaggtaggtaggtaggt 81675 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 81690 aggtaggtaggtaggtaggt 81671 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 81686 aggtaggtaggtaggtaggt 81667
>gb|AC158904.4| Mus musculus chromosome 19, clone RP23-16C24, complete sequence Length = 219567 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 148698 caggtaggtaggtaggtaggt 148678 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148693 aggtaggtaggtaggtaggt 148674 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148689 aggtaggtaggtaggtaggt 148670 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148685 aggtaggtaggtaggtaggt 148666 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148681 aggtaggtaggtaggtaggt 148662 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148677 aggtaggtaggtaggtaggt 148658 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148673 aggtaggtaggtaggtaggt 148654 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148669 aggtaggtaggtaggtaggt 148650
>gb|AC163212.3| Mus musculus chromosome 3, clone RP24-102O2, complete sequence Length = 199319 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 109577 caggtaggtaggtaggtaggt 109557
>emb|BX295538.1|NC45B12 Neurospora crassa DNA linkage group VI Cosmid clone 45B12 Length = 37178 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 9023 caggtaggtaggtaggtaggt 9043 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30759 aggtaggtaggtaggtaggt 30740 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30755 aggtaggtaggtaggtaggt 30736 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30751 aggtaggtaggtaggtaggt 30732 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30747 aggtaggtaggtaggtaggt 30728 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30743 aggtaggtaggtaggtaggt 30724 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30739 aggtaggtaggtaggtaggt 30720 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30735 aggtaggtaggtaggtaggt 30716 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30731 aggtaggtaggtaggtaggt 30712 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30727 aggtaggtaggtaggtaggt 30708 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30723 aggtaggtaggtaggtaggt 30704 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30719 aggtaggtaggtaggtaggt 30700 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30715 aggtaggtaggtaggtaggt 30696 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30711 aggtaggtaggtaggtaggt 30692 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30707 aggtaggtaggtaggtaggt 30688 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30703 aggtaggtaggtaggtaggt 30684 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30699 aggtaggtaggtaggtaggt 30680 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30695 aggtaggtaggtaggtaggt 30676 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 9059 aggtaggtaggtaggtaggt 9078 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8972 aggtaggtaggtaggtaggt 8991 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8968 aggtaggtaggtaggtaggt 8987 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8964 aggtaggtaggtaggtaggt 8983 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8960 aggtaggtaggtaggtaggt 8979 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8956 aggtaggtaggtaggtaggt 8975 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8952 aggtaggtaggtaggtaggt 8971 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8948 aggtaggtaggtaggtaggt 8967 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8944 aggtaggtaggtaggtaggt 8963 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8920 aggtaggtaggtaggtaggt 8939 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8916 aggtaggtaggtaggtaggt 8935 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8912 aggtaggtaggtaggtaggt 8931 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 8703 aggtaggtaggtaggtaggt 8722
>emb|AL672234.27| Mouse DNA sequence from clone RP23-356I16 on chromosome 8, complete sequence Length = 221012 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 75891 aggtaggtaggtaggtaggtt 75871
>emb|AL807369.1|NCG15D1 Neurospora crassa DNA linkage group V cosmid contig G15D1 Length = 62178 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 23313 caggtaggtaggtaggtaggt 23333 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23430 aggtaggtaggtaggtaggt 23449 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23426 aggtaggtaggtaggtaggt 23445 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23422 aggtaggtaggtaggtaggt 23441 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23418 aggtaggtaggtaggtaggt 23437 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23414 aggtaggtaggtaggtaggt 23433 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23410 aggtaggtaggtaggtaggt 23429 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23406 aggtaggtaggtaggtaggt 23425 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23402 aggtaggtaggtaggtaggt 23421 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23398 aggtaggtaggtaggtaggt 23417 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23394 aggtaggtaggtaggtaggt 23413 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23390 aggtaggtaggtaggtaggt 23409 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23386 aggtaggtaggtaggtaggt 23405 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23382 aggtaggtaggtaggtaggt 23401 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23378 aggtaggtaggtaggtaggt 23397 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23374 aggtaggtaggtaggtaggt 23393 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23370 aggtaggtaggtaggtaggt 23389 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23366 aggtaggtaggtaggtaggt 23385 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23362 aggtaggtaggtaggtaggt 23381 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23358 aggtaggtaggtaggtaggt 23377 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23354 aggtaggtaggtaggtaggt 23373 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23350 aggtaggtaggtaggtaggt 23369 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23346 aggtaggtaggtaggtaggt 23365 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23342 aggtaggtaggtaggtaggt 23361 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23338 aggtaggtaggtaggtaggt 23357 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23334 aggtaggtaggtaggtaggt 23353 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23330 aggtaggtaggtaggtaggt 23349 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23326 aggtaggtaggtaggtaggt 23345 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23322 aggtaggtaggtaggtaggt 23341 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23318 aggtaggtaggtaggtaggt 23337
>emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cosmid contig 62D11 Length = 102165 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 87994 caggtaggtaggtaggtaggt 88014 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88111 aggtaggtaggtaggtaggt 88130 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88107 aggtaggtaggtaggtaggt 88126 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88103 aggtaggtaggtaggtaggt 88122 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88099 aggtaggtaggtaggtaggt 88118 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88095 aggtaggtaggtaggtaggt 88114 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88091 aggtaggtaggtaggtaggt 88110 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88087 aggtaggtaggtaggtaggt 88106 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88083 aggtaggtaggtaggtaggt 88102 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88079 aggtaggtaggtaggtaggt 88098 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88075 aggtaggtaggtaggtaggt 88094 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88071 aggtaggtaggtaggtaggt 88090 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88067 aggtaggtaggtaggtaggt 88086 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88063 aggtaggtaggtaggtaggt 88082 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88059 aggtaggtaggtaggtaggt 88078 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88055 aggtaggtaggtaggtaggt 88074 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88051 aggtaggtaggtaggtaggt 88070 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88047 aggtaggtaggtaggtaggt 88066 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88043 aggtaggtaggtaggtaggt 88062 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88039 aggtaggtaggtaggtaggt 88058 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88035 aggtaggtaggtaggtaggt 88054 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88031 aggtaggtaggtaggtaggt 88050 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88027 aggtaggtaggtaggtaggt 88046 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88023 aggtaggtaggtaggtaggt 88042 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88019 aggtaggtaggtaggtaggt 88038 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88015 aggtaggtaggtaggtaggt 88034 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88011 aggtaggtaggtaggtaggt 88030 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88007 aggtaggtaggtaggtaggt 88026 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 88003 aggtaggtaggtaggtaggt 88022 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87999 aggtaggtaggtaggtaggt 88018
>emb|AL513412.3|HS403H13 Homo sapiens chromosome 9 BAC RP11-403H13, complete sequence Length = 191668 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 74589 aggtaggtaggtaggtaggtt 74569
>emb|AL513462.1|NCB8L3 Neurospora crassa DNA linkage group V BAC contig B8L3 Length = 112716 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 12223 aggtaggtaggtaggtaggtt 12243 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 106107 aggtaggtaggtaggtaggt 106126 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 106103 aggtaggtaggtaggtaggt 106122 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 106099 aggtaggtaggtaggtaggt 106118 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 106095 aggtaggtaggtaggtaggt 106114 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 106091 aggtaggtaggtaggtaggt 106110 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12219 aggtaggtaggtaggtaggt 12238 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12215 aggtaggtaggtaggtaggt 12234 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12211 aggtaggtaggtaggtaggt 12230 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12207 aggtaggtaggtaggtaggt 12226 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12203 aggtaggtaggtaggtaggt 12222 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12199 aggtaggtaggtaggtaggt 12218 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12195 aggtaggtaggtaggtaggt 12214 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12191 aggtaggtaggtaggtaggt 12210 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12187 aggtaggtaggtaggtaggt 12206 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12183 aggtaggtaggtaggtaggt 12202 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12179 aggtaggtaggtaggtaggt 12198 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12175 aggtaggtaggtaggtaggt 12194 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12171 aggtaggtaggtaggtaggt 12190 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12167 aggtaggtaggtaggtaggt 12186 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12163 aggtaggtaggtaggtaggt 12182 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12159 aggtaggtaggtaggtaggt 12178 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12155 aggtaggtaggtaggtaggt 12174 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12151 aggtaggtaggtaggtaggt 12170 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12147 aggtaggtaggtaggtaggt 12166 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12143 aggtaggtaggtaggtaggt 12162 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12139 aggtaggtaggtaggtaggt 12158 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12135 aggtaggtaggtaggtaggt 12154 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12131 aggtaggtaggtaggtaggt 12150 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12127 aggtaggtaggtaggtaggt 12146 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12123 aggtaggtaggtaggtaggt 12142 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12119 aggtaggtaggtaggtaggt 12138 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12115 aggtaggtaggtaggtaggt 12134 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12111 aggtaggtaggtaggtaggt 12130 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12107 aggtaggtaggtaggtaggt 12126 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12103 aggtaggtaggtaggtaggt 12122 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12099 aggtaggtaggtaggtaggt 12118 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12095 aggtaggtaggtaggtaggt 12114 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12091 aggtaggtaggtaggtaggt 12110 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 12087 aggtaggtaggtaggtaggt 12106
>emb|AL513466.1|NCB18D24 Neurospora crassa DNA linkage group V BAC contig B18D24 Length = 157180 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 93178 aggtaggtaggtaggtaggtt 93198 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 93174 aggtaggtaggtaggtaggt 93193 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 93170 aggtaggtaggtaggtaggt 93189
>emb|AL451109.1|NCB11A5 Neurospora crassa DNA linkage group V BAC clone B11A5 Length = 74109 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 50408 aggtaggtaggtaggtaggtt 50428 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50404 aggtaggtaggtaggtaggt 50423 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50400 aggtaggtaggtaggtaggt 50419 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50396 aggtaggtaggtaggtaggt 50415 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50392 aggtaggtaggtaggtaggt 50411 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50388 aggtaggtaggtaggtaggt 50407 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50384 aggtaggtaggtaggtaggt 50403 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50380 aggtaggtaggtaggtaggt 50399 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50376 aggtaggtaggtaggtaggt 50395 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50372 aggtaggtaggtaggtaggt 50391 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50368 aggtaggtaggtaggtaggt 50387 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50364 aggtaggtaggtaggtaggt 50383 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50360 aggtaggtaggtaggtaggt 50379 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50356 aggtaggtaggtaggtaggt 50375 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50352 aggtaggtaggtaggtaggt 50371 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50348 aggtaggtaggtaggtaggt 50367 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50344 aggtaggtaggtaggtaggt 50363 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50340 aggtaggtaggtaggtaggt 50359 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50336 aggtaggtaggtaggtaggt 50355 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50332 aggtaggtaggtaggtaggt 50351 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50328 aggtaggtaggtaggtaggt 50347 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50324 aggtaggtaggtaggtaggt 50343 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50320 aggtaggtaggtaggtaggt 50339 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50316 aggtaggtaggtaggtaggt 50335 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50312 aggtaggtaggtaggtaggt 50331 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50308 aggtaggtaggtaggtaggt 50327 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50304 aggtaggtaggtaggtaggt 50323 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50300 aggtaggtaggtaggtaggt 50319 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50296 aggtaggtaggtaggtaggt 50315 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50292 aggtaggtaggtaggtaggt 50311 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50288 aggtaggtaggtaggtaggt 50307 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50284 aggtaggtaggtaggtaggt 50303 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50280 aggtaggtaggtaggtaggt 50299 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50276 aggtaggtaggtaggtaggt 50295 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 50272 aggtaggtaggtaggtaggt 50291
>gb|AC160145.6| Mus musculus 10 BAC RP24-160D12 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 155235 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 98124 caggtaggtaggtaggtaggt 98144 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 98129 aggtaggtaggtaggtaggt 98148
>emb|CR628365.6| Zebrafish DNA sequence from clone CH211-137O16 in linkage group 11, complete sequence Length = 191036 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 264 tcttttgattctgacttatca 284 ||||||||||||||||||||| Sbjct: 106379 tcttttgattctgacttatca 106359
>emb|BX936324.6| Zebrafish DNA sequence from clone CH211-74F16 in linkage group 3, complete sequence Length = 154312 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 47238 caggtaggtaggtaggtaggt 47258 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47355 aggtaggtaggtaggtaggt 47374 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47351 aggtaggtaggtaggtaggt 47370 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47347 aggtaggtaggtaggtaggt 47366 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47343 aggtaggtaggtaggtaggt 47362 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47339 aggtaggtaggtaggtaggt 47358 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47335 aggtaggtaggtaggtaggt 47354 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47331 aggtaggtaggtaggtaggt 47350 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47327 aggtaggtaggtaggtaggt 47346 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47323 aggtaggtaggtaggtaggt 47342 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47319 aggtaggtaggtaggtaggt 47338 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47315 aggtaggtaggtaggtaggt 47334 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47311 aggtaggtaggtaggtaggt 47330 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47307 aggtaggtaggtaggtaggt 47326 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47303 aggtaggtaggtaggtaggt 47322 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47299 aggtaggtaggtaggtaggt 47318 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47295 aggtaggtaggtaggtaggt 47314 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47291 aggtaggtaggtaggtaggt 47310 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47287 aggtaggtaggtaggtaggt 47306 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47283 aggtaggtaggtaggtaggt 47302 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47279 aggtaggtaggtaggtaggt 47298 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47275 aggtaggtaggtaggtaggt 47294 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47271 aggtaggtaggtaggtaggt 47290 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47267 aggtaggtaggtaggtaggt 47286 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47263 aggtaggtaggtaggtaggt 47282 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47259 aggtaggtaggtaggtaggt 47278 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47255 aggtaggtaggtaggtaggt 47274 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47251 aggtaggtaggtaggtaggt 47270 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47247 aggtaggtaggtaggtaggt 47266 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47243 aggtaggtaggtaggtaggt 47262
>emb|BX649198.6| Zebrafish DNA sequence from clone DKEY-18L1 in linkage group 9, complete sequence Length = 139896 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 111101 caggtaggtaggtaggtaggt 111121
>emb|CR381576.10| Zebrafish DNA sequence from clone DKEY-245F17 in linkage group 17, complete sequence Length = 185749 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 89867 aggtaggtaggtaggtaggtt 89887 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89863 aggtaggtaggtaggtaggt 89882 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89859 aggtaggtaggtaggtaggt 89878 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89855 aggtaggtaggtaggtaggt 89874 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89851 aggtaggtaggtaggtaggt 89870 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89847 aggtaggtaggtaggtaggt 89866 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89843 aggtaggtaggtaggtaggt 89862 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89839 aggtaggtaggtaggtaggt 89858 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89835 aggtaggtaggtaggtaggt 89854 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89831 aggtaggtaggtaggtaggt 89850 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89827 aggtaggtaggtaggtaggt 89846 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89823 aggtaggtaggtaggtaggt 89842 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89819 aggtaggtaggtaggtaggt 89838 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89815 aggtaggtaggtaggtaggt 89834 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89811 aggtaggtaggtaggtaggt 89830 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89807 aggtaggtaggtaggtaggt 89826 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89803 aggtaggtaggtaggtaggt 89822 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89799 aggtaggtaggtaggtaggt 89818 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89795 aggtaggtaggtaggtaggt 89814 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89791 aggtaggtaggtaggtaggt 89810 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89787 aggtaggtaggtaggtaggt 89806 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89783 aggtaggtaggtaggtaggt 89802 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89779 aggtaggtaggtaggtaggt 89798 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 89775 aggtaggtaggtaggtaggt 89794
>emb|BX640500.10| Zebrafish DNA sequence from clone RP71-86I11 in linkage group 9, complete sequence Length = 120013 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 916 aggtaggtaggtaggtaggtt 896 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 936 aggtaggtaggtaggtaggt 917 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 932 aggtaggtaggtaggtaggt 913 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 928 aggtaggtaggtaggtaggt 909 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 924 aggtaggtaggtaggtaggt 905 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 920 aggtaggtaggtaggtaggt 901
>emb|AL662810.16| Mouse DNA sequence from clone RP23-42P24 on chromosome 11 Contains a novel gene (9630006B20Rik), a novel gene, a ribosomal protein S12 (Rps12) pseudogene, a novel gene (LOC268391), the Bcl11a gene for B-cell CLL/lymphoma 11A (zinc finger protein), two novel genes and three CpG islands, complete sequence Length = 267641 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 36491 aggtaggtaggtaggtaggtt 36471 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 36519 aggtaggtaggtaggtaggt 36500 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 36515 aggtaggtaggtaggtaggt 36496 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 36511 aggtaggtaggtaggtaggt 36492 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 36507 aggtaggtaggtaggtaggt 36488 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 36503 aggtaggtaggtaggtaggt 36484 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 36499 aggtaggtaggtaggtaggt 36480 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 36495 aggtaggtaggtaggtaggt 36476
>emb|AL646002.6| Mouse DNA sequence from clone RP23-237P10 on chromosome 11 Contains gene D930008C07Rik, the Canx gene for calnexin, a high mobility group nucleosomal binding domain 2 (Hmgn2) pseudogene and two CpG islands, complete sequence Length = 113907 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 91522 aggtaggtaggtaggtaggtt 91502 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 91526 aggtaggtaggtaggtaggt 91507
>emb|CR388169.7| Zebrafish DNA sequence from clone DKEYP-61H1 in linkage group 3, complete sequence Length = 89582 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 39445 caggtaggtaggtaggtaggt 39465 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 39454 aggtaggtaggtaggtaggt 39473 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 39450 aggtaggtaggtaggtaggt 39469
>emb|BX511086.5| Zebrafish DNA sequence from clone DKEY-38P8 in linkage group 7, complete sequence Length = 228170 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 26266 aggtaggtaggtaggtaggtt 26286 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27900 aggtaggtaggtaggtaggt 27919 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27896 aggtaggtaggtaggtaggt 27915 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27892 aggtaggtaggtaggtaggt 27911 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27888 aggtaggtaggtaggtaggt 27907 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27884 aggtaggtaggtaggtaggt 27903 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27880 aggtaggtaggtaggtaggt 27899 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27876 aggtaggtaggtaggtaggt 27895 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27872 aggtaggtaggtaggtaggt 27891 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27868 aggtaggtaggtaggtaggt 27887 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27864 aggtaggtaggtaggtaggt 27883 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27860 aggtaggtaggtaggtaggt 27879 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27856 aggtaggtaggtaggtaggt 27875 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27852 aggtaggtaggtaggtaggt 27871 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27848 aggtaggtaggtaggtaggt 27867 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27844 aggtaggtaggtaggtaggt 27863 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 27840 aggtaggtaggtaggtaggt 27859 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26629 aggtaggtaggtaggtaggt 26648 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26625 aggtaggtaggtaggtaggt 26644 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26262 aggtaggtaggtaggtaggt 26281 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24227 aggtaggtaggtaggtaggt 24246 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24223 aggtaggtaggtaggtaggt 24242 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24219 aggtaggtaggtaggtaggt 24238 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24215 aggtaggtaggtaggtaggt 24234 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24211 aggtaggtaggtaggtaggt 24230 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24207 aggtaggtaggtaggtaggt 24226 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24203 aggtaggtaggtaggtaggt 24222 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 24199 aggtaggtaggtaggtaggt 24218 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16217 aggtaggtaggtaggtaggt 16236 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16213 aggtaggtaggtaggtaggt 16232 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16209 aggtaggtaggtaggtaggt 16228 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16205 aggtaggtaggtaggtaggt 16224 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16201 aggtaggtaggtaggtaggt 16220 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16197 aggtaggtaggtaggtaggt 16216 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16193 aggtaggtaggtaggtaggt 16212 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16189 aggtaggtaggtaggtaggt 16208 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16185 aggtaggtaggtaggtaggt 16204 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16181 aggtaggtaggtaggtaggt 16200 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16177 aggtaggtaggtaggtaggt 16196 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16173 aggtaggtaggtaggtaggt 16192 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16169 aggtaggtaggtaggtaggt 16188 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16165 aggtaggtaggtaggtaggt 16184
>emb|CR846083.9| Zebrafish DNA sequence from clone DKEYP-34A6 in linkage group 14, complete sequence Length = 163337 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 260 cctctcttttgattctgactt 280 ||||||||||||||||||||| Sbjct: 93127 cctctcttttgattctgactt 93147
>emb|BX294444.7| Zebrafish DNA sequence from clone CH211-281E15 in linkage group 14, complete sequence Length = 169694 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 260 cctctcttttgattctgactt 280 ||||||||||||||||||||| Sbjct: 92568 cctctcttttgattctgactt 92588
>emb|AL807239.5| Zebrafish DNA sequence from clone CH211-231H1 in linkage group 14 Contains the 5' part of a novel gene similar to human, rodent and Oreochromis mossambicus GRIA3 (ionotropic glutamate receptor AMPA3) and five CpG islands, complete sequence Length = 210702 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 148742 aggtaggtaggtaggtaggtt 148722 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148750 aggtaggtaggtaggtaggt 148731 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 148746 aggtaggtaggtaggtaggt 148727
>emb|CR846096.4| Zebrafish DNA sequence from clone DKEYP-8C10 in linkage group 14, complete sequence Length = 91350 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 42053 aggtaggtaggtaggtaggtt 42073
>emb|BX322643.8| Zebrafish DNA sequence from clone CH211-281E1 in linkage group 21, complete sequence Length = 153972 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 86743 aggtaggtaggtaggtaggtt 86723
>emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 in linkage group 8, complete sequence Length = 137166 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 10468 caggtaggtaggtaggtaggt 10448 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 10463 aggtaggtaggtaggtaggt 10444 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 10459 aggtaggtaggtaggtaggt 10440
>gb|AC159242.2| Mus musculus BAC clone RP24-325A23 from chromosome 13, complete sequence Length = 193570 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 154632 caggtaggtaggtaggtaggt 154612
>gb|AC078816.16| Homo sapiens 3 BAC RP11-600P18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 183861 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 27697 caggtaggtaggtaggtaggt 27677
>gb|AC105282.5| Homo sapiens chromosome 18, clone RP11-452F20, complete sequence Length = 167258 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 154 gcatcaggtaggtaggtaggtaggt 178 |||| |||||||||||||||||||| Sbjct: 84264 gcattaggtaggtaggtaggtaggt 84240
>emb|BX663615.15| Zebrafish DNA sequence from clone DKEY-14B2 in linkage group 7, complete sequence Length = 212543 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 47324 caggtaggtaggtaggtaggt 47304 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47319 aggtaggtaggtaggtaggt 47300
>gb|AC113267.14| Papio anubis clone rp41-174i6, complete sequence Length = 154605 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 139408 caggtaggtaggtaggtaggt 139428 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 139413 aggtaggtaggtaggtaggt 139432
>emb|BX323800.8| Zebrafish DNA sequence from clone DKEYP-73A2 in linkage group 11, complete sequence Length = 195592 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 174445 aggtaggtaggtaggtaggtt 174425 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 174449 aggtaggtaggtaggtaggt 174430
>gb|AC156278.8| Mus musculus 6 BAC RP24-249N9 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 162919 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 69575 aggtaggtaggtaggtaggtt 69555 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 69579 aggtaggtaggtaggtaggt 69560
>gb|AC105314.5| Homo sapiens BAC clone RP11-312H15 from 4, complete sequence Length = 193665 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 146276 aggtaggtaggtaggtaggtt 146256 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 146344 aggtaggtaggtaggtaggt 146325 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 146340 aggtaggtaggtaggtaggt 146321 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 146336 aggtaggtaggtaggtaggt 146317 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 146332 aggtaggtaggtaggtaggt 146313 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 146328 aggtaggtaggtaggtaggt 146309 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 146324 aggtaggtaggtaggtaggt 146305 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 146320 aggtaggtaggtaggtaggt 146301
>gb|AC092279.2| Homo sapiens chromosome 19 clone CTD-2017D11, complete sequence Length = 117559 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 54928 caggtaggtaggtaggtaggt 54908 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 54923 aggtaggtaggtaggtaggt 54904
>gb|AC090312.7| Homo sapiens chromosome 18, clone RP11-752P2, complete sequence Length = 171438 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 158750 caggtaggtaggtaggtaggt 158770
>gb|AC011400.5| Homo sapiens chromosome 5 clone CTB-31E20, complete sequence Length = 160378 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 150329 caggtaggtaggtaggtaggt 150349 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 150338 aggtaggtaggtaggtaggt 150357 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 150334 aggtaggtaggtaggtaggt 150353
>gb|AF411849.1|AF411849S1 Homo sapiens USH3 region, partial sequence Length = 198334 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 130384 caggtaggtaggtaggtaggt 130364
>gb|AC160983.2| Mus musculus BAC clone RP23-335A9 from chromosome 9, complete sequence Length = 188085 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 3672 caggtaggtaggtaggtaggt 3692 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 3677 aggtaggtaggtaggtaggt 3696
>gb|AC034154.6| Homo sapiens BAC clone RP11-242D9 from 4, complete sequence Length = 210563 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 60300 caggtaggtaggtaggtaggt 60280
>gb|AC093246.3| Homo sapiens chromosome 5 clone RP11-117L6, complete sequence Length = 175154 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 30369 caggtaggtaggtaggtaggt 30389 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30378 aggtaggtaggtaggtaggt 30397 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30374 aggtaggtaggtaggtaggt 30393
>dbj|AK163501.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230312F04 product:hypothetical protein, full insert sequence Length = 5617 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 5336 caggtaggtaggtaggtaggt 5316 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5331 aggtaggtaggtaggtaggt 5312 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5327 aggtaggtaggtaggtaggt 5308 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5323 aggtaggtaggtaggtaggt 5304 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5319 aggtaggtaggtaggtaggt 5300
>gb|AC015687.11| Homo sapiens chromosome , clone RP11-18M5, complete sequence Length = 188571 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 156 atcaggtaggtaggtaggtag 176 ||||||||||||||||||||| Sbjct: 88171 atcaggtaggtaggtaggtag 88191
>gb|AC026696.5| Homo sapiens chromosome 5 clone CTC-348L14, complete sequence Length = 125862 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 67844 caggtaggtaggtaggtaggt 67824 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 67839 aggtaggtaggtaggtaggt 67820 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 67835 aggtaggtaggtaggtaggt 67816 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 67831 aggtaggtaggtaggtaggt 67812 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 67827 aggtaggtaggtaggtaggt 67808 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 67823 aggtaggtaggtaggtaggt 67804 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 67819 aggtaggtaggtaggtaggt 67800 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 67815 aggtaggtaggtaggtaggt 67796
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 5183028 caggtaggtaggtaggtaggt 5183048 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 5183033 aggtaggtaggtaggtaggt 5183052
>emb|BX511080.4| Zebrafish DNA sequence from clone DKEY-237N7 in linkage group 3, complete sequence Length = 115272 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 92740 caggtaggtaggtaggtaggt 92760
>emb|BX649555.9| Zebrafish DNA sequence from clone CH211-117C13 in linkage group 16, complete sequence Length = 163314 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 44476 caggtaggtaggtaggtaggt 44496 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 44485 aggtaggtaggtaggtaggt 44504 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 44481 aggtaggtaggtaggtaggt 44500
>emb|BX470097.9| Zebrafish DNA sequence from clone DKEYP-114E10 in linkage group 5, complete sequence Length = 96967 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 16133 caggtaggtaggtaggtaggt 16153 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16142 aggtaggtaggtaggtaggt 16161 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 16138 aggtaggtaggtaggtaggt 16157
>gb|AC154118.6| Mus musculus chromosome 19, clone RP24-340C10, complete sequence Length = 141422 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 62057 aggtaggtaggtaggtaggtt 62037 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62089 aggtaggtaggtaggtaggt 62070 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62065 aggtaggtaggtaggtaggt 62046 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62061 aggtaggtaggtaggtaggt 62042 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62036 aggtaggtaggtaggtaggt 62017 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62032 aggtaggtaggtaggtaggt 62013 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62028 aggtaggtaggtaggtaggt 62009 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62024 aggtaggtaggtaggtaggt 62005 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62020 aggtaggtaggtaggtaggt 62001 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62016 aggtaggtaggtaggtaggt 61997 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 62012 aggtaggtaggtaggtaggt 61993
>emb|BX571770.5| Zebrafish DNA sequence from clone DKEY-276I5 in linkage group 24, complete sequence Length = 210504 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 185491 aggtaggtaggtaggtaggtt 185511 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 185487 aggtaggtaggtaggtaggt 185506 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 185483 aggtaggtaggtaggtaggt 185502 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 185479 aggtaggtaggtaggtaggt 185498
>gb|AC161889.5| Mus musculus 10 BAC RP23-361O18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 228043 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 94521 caggtaggtaggtaggtaggt 94501 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 94516 aggtaggtaggtaggtaggt 94497 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 94512 aggtaggtaggtaggtaggt 94493 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 94508 aggtaggtaggtaggtaggt 94489
>emb|BX324146.10| Zebrafish DNA sequence from clone CH211-207C15 in linkage group 19, complete sequence Length = 230267 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 47084 caggtaggtaggtaggtaggt 47064 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 47079 aggtaggtaggtaggtaggt 47060
>gb|AC159966.5| Mus musculus chromosome 1, clone RP23-287P12, complete sequence Length = 208142 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 108599 aggtaggtaggtaggtaggtt 108579 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108627 aggtaggtaggtaggtaggt 108608 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108623 aggtaggtaggtaggtaggt 108604 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108619 aggtaggtaggtaggtaggt 108600 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108615 aggtaggtaggtaggtaggt 108596 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108611 aggtaggtaggtaggtaggt 108592 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108607 aggtaggtaggtaggtaggt 108588 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 108603 aggtaggtaggtaggtaggt 108584
>gb|AC161588.2| Mus musculus BAC clone RP24-447G12 from chromosome 13, complete sequence Length = 211917 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 210693 aggtaggtaggtaggtaggtt 210713
>dbj|AK008146.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010007E15 product:unclassifiable, full insert sequence Length = 1233 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 1119 aggtaggtaggtaggtaggtt 1099 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 1131 aggtaggtaggtaggtaggt 1112 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 1127 aggtaggtaggtaggtaggt 1108 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 1123 aggtaggtaggtaggtaggt 1104
>gb|AC153820.4| Mus musculus 6 BAC RP23-459L15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180996 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 148 tactgcgcatcaggtaggtag 168 ||||||||||||||||||||| Sbjct: 146156 tactgcgcatcaggtaggtag 146136
>gb|AC153886.3| Mus musculus 10 BAC RP23-461H13 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 155429 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 28803 caggtaggtaggtaggtaggt 28783 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28798 aggtaggtaggtaggtaggt 28779 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28794 aggtaggtaggtaggtaggt 28775 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28790 aggtaggtaggtaggtaggt 28771 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28786 aggtaggtaggtaggtaggt 28767 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28782 aggtaggtaggtaggtaggt 28763 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28778 aggtaggtaggtaggtaggt 28759 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 28774 aggtaggtaggtaggtaggt 28755
>gb|AC024751.2| Caenorhabditis elegans cosmid Y18H1A, complete sequence Length = 89984 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 63413 caggtaggtaggtaggtaggt 63433 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 63158 caggtaggtaggtaggtaggt 63178 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65585 aggtaggtaggtaggtaggt 65604 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65581 aggtaggtaggtaggtaggt 65600 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65577 aggtaggtaggtaggtaggt 65596 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65573 aggtaggtaggtaggtaggt 65592 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65569 aggtaggtaggtaggtaggt 65588 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65565 aggtaggtaggtaggtaggt 65584 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65561 aggtaggtaggtaggtaggt 65580 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65557 aggtaggtaggtaggtaggt 65576 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65553 aggtaggtaggtaggtaggt 65572 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65549 aggtaggtaggtaggtaggt 65568 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 65545 aggtaggtaggtaggtaggt 65564 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63932 aggtaggtaggtaggtaggt 63951 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63928 aggtaggtaggtaggtaggt 63947 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63924 aggtaggtaggtaggtaggt 63943 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63920 aggtaggtaggtaggtaggt 63939 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63747 aggtaggtaggtaggtaggt 63766 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63199 aggtaggtaggtaggtaggt 63218 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63195 aggtaggtaggtaggtaggt 63214 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63191 aggtaggtaggtaggtaggt 63210 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63187 aggtaggtaggtaggtaggt 63206 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63183 aggtaggtaggtaggtaggt 63202 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63179 aggtaggtaggtaggtaggt 63198 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63175 aggtaggtaggtaggtaggt 63194 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63171 aggtaggtaggtaggtaggt 63190 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63167 aggtaggtaggtaggtaggt 63186 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63163 aggtaggtaggtaggtaggt 63182
>gb|AC006674.3| Caenorhabditis elegans cosmid K12H6, complete sequence Length = 39370 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 23646 caggtaggtaggtaggtaggt 23626 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23568 aggtaggtaggtaggtaggt 23549
>gb|AC117503.8| Homo sapiens 12 BAC RP11-338K17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 218476 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 60194 caggtaggtaggtaggtaggt 60214 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 60199 aggtaggtaggtaggtaggt 60218
>gb|AC022846.9| Homo sapiens chromosome 8, clone RP11-253N21, complete sequence Length = 123570 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 62053 aggtaggtaggtaggtaggtt 62073
>gb|AC108066.3| Homo sapiens BAC clone RP11-521H5 from 2, complete sequence Length = 158599 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 5265 caggtaggtaggtaggtaggt 5245
>gb|AC010598.6| Homo sapiens chromosome 5 clone CTC-560O9, complete sequence Length = 174551 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 138424 caggtaggtaggtaggtaggt 138444 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138445 aggtaggtaggtaggtaggt 138464 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138441 aggtaggtaggtaggtaggt 138460 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138437 aggtaggtaggtaggtaggt 138456 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138433 aggtaggtaggtaggtaggt 138452 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138429 aggtaggtaggtaggtaggt 138448
>gb|AC154767.2| Mus musculus BAC clone RP23-105P19 from chromosome 13, complete sequence Length = 189362 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 152579 caggtaggtaggtaggtaggt 152599
>gb|AC155263.2| Mus musculus BAC clone RP23-415I11 from chromosome 13, complete sequence Length = 202801 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 161414 aggtaggtaggtaggtaggtt 161394 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 91295 aggtaggtaggtaggtaggt 91314 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 91291 aggtaggtaggtaggtaggt 91310 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 91287 aggtaggtaggtaggtaggt 91306 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 91283 aggtaggtaggtaggtaggt 91302
>gb|AC152506.2| Pan troglodytes BAC clone RP43-4B9 from chromosome 7, complete sequence Length = 181146 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 9314 aggtaggtaggtaggtaggtt 9294
>gb|AC079775.6| Homo sapiens BAC clone RP11-295P2 from 2, complete sequence Length = 171987 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 117054 aggtaggtaggtaggtaggtt 117034 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 117058 aggtaggtaggtaggtaggt 117039
>gb|AC006062.5| Homo sapiens X BAC GS1-199J3 (Genome Systems Human BAC Library) complete sequence Length = 122681 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 91481 caggtaggtaggtaggtaggt 91501
>gb|AC024255.22|AC024255 Homo sapiens 12 BAC RP11-31A23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 165236 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 13238 caggtaggtaggtaggtaggt 13218 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13233 aggtaggtaggtaggtaggt 13214
>emb|AL929240.18| Mouse DNA sequence from clone RP23-245A10 on chromosome 2, complete sequence Length = 180092 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 49722 aggtaggtaggtaggtaggtt 49702 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 135370 aggtaggtaggtaggtaggt 135351 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 135366 aggtaggtaggtaggtaggt 135347 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 135362 aggtaggtaggtaggtaggt 135343 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 49726 aggtaggtaggtaggtaggt 49707
>gb|AC073533.19| Homo sapiens X BAC RP11-589J20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 182056 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 127747 caggtaggtaggtaggtaggt 127727
>gb|AC159218.3| Pan troglodytes BAC clone CH251-59O2 from chromosome unknown, complete sequence Length = 178970 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 143187 caggtaggtaggtaggtaggt 143207 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143208 aggtaggtaggtaggtaggt 143227 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143204 aggtaggtaggtaggtaggt 143223 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143200 aggtaggtaggtaggtaggt 143219 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143196 aggtaggtaggtaggtaggt 143215 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 143192 aggtaggtaggtaggtaggt 143211
>gb|AC079183.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-258N2, complete sequence Length = 170233 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 13613 caggtaggtaggtaggtaggt 13633 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13646 aggtaggtaggtaggtaggt 13665 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13642 aggtaggtaggtaggtaggt 13661 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13638 aggtaggtaggtaggtaggt 13657 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13634 aggtaggtaggtaggtaggt 13653 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13630 aggtaggtaggtaggtaggt 13649 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13626 aggtaggtaggtaggtaggt 13645 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13622 aggtaggtaggtaggtaggt 13641 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13618 aggtaggtaggtaggtaggt 13637
>emb|BX294119.5| Zebrafish DNA sequence from clone CH211-113D22 in linkage group 10, complete sequence Length = 167603 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 60866 aggtaggtaggtaggtaggtt 60846
>emb|BX545849.7| Mouse DNA sequence from clone RP23-232N16 on chromosome 4, complete sequence Length = 114104 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 35001 caggtaggtaggtaggtaggt 35021 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35010 aggtaggtaggtaggtaggt 35029 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35006 aggtaggtaggtaggtaggt 35025
>emb|AL671981.12| Mouse DNA sequence from clone RP23-358P8 on chromosome X, complete sequence Length = 167604 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 153092 aggtaggtaggtaggtaggtt 153072 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 153112 aggtaggtaggtaggtaggt 153093 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 153108 aggtaggtaggtaggtaggt 153089 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 153104 aggtaggtaggtaggtaggt 153085 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 153100 aggtaggtaggtaggtaggt 153081 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 153096 aggtaggtaggtaggtaggt 153077
>emb|BX530412.8| Zebrafish DNA sequence from clone DKEY-42F6 in linkage group 4, complete sequence Length = 218203 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 104148 caggtaggtaggtaggtaggt 104128 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 104143 aggtaggtaggtaggtaggt 104124
>gb|AC005003.2|AC005003 Homo sapiens PAC clone RP3-400N23 from 22q11.2-q22, complete sequence Length = 65750 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 6246 aggtaggtaggtaggtaggtt 6266 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 6203 aggtaggtaggtaggtaggtt 6223 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6281 aggtaggtaggtaggtaggt 6300 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6242 aggtaggtaggtaggtaggt 6261 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6238 aggtaggtaggtaggtaggt 6257 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6199 aggtaggtaggtaggtaggt 6218 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6195 aggtaggtaggtaggtaggt 6214 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 6191 aggtaggtaggtaggtaggt 6210
>gb|AC154511.2| Mus musculus BAC clone RP24-69N19 from 13, complete sequence Length = 197061 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 97090 caggtaggtaggtaggtaggt 97070
>gb|AC154529.2| Mus musculus BAC clone RP23-463N16 from 16, complete sequence Length = 177958 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 167970 caggtaggtaggtaggtaggt 167990
>emb|CR792414.6| Zebrafish DNA sequence from clone CH211-95O10 in linkage group 4, complete sequence Length = 66595 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 31917 caggtaggtaggtaggtaggt 31937 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 31922 aggtaggtaggtaggtaggt 31941
>emb|BX927361.31| Zebrafish DNA sequence from clone CH211-121K8 in linkage group 9, complete sequence Length = 177986 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 90576 aggtaggtaggtaggtaggtt 90556 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 90612 aggtaggtaggtaggtaggt 90593 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 90608 aggtaggtaggtaggtaggt 90589 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 90528 aggtaggtaggtaggtaggt 90509 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 90376 aggtaggtaggtaggtaggt 90357 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 90372 aggtaggtaggtaggtaggt 90353
>gb|AC006769.1| Caenorhabditis elegans cosmid Y45G12C, complete sequence Length = 51235 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 19784 caggtaggtaggtaggtaggt 19804 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 19644 caggtaggtaggtaggtaggt 19664 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19761 aggtaggtaggtaggtaggt 19780 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19757 aggtaggtaggtaggtaggt 19776 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19753 aggtaggtaggtaggtaggt 19772 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19749 aggtaggtaggtaggtaggt 19768 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19745 aggtaggtaggtaggtaggt 19764 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19741 aggtaggtaggtaggtaggt 19760 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19737 aggtaggtaggtaggtaggt 19756 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19733 aggtaggtaggtaggtaggt 19752 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19729 aggtaggtaggtaggtaggt 19748 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19725 aggtaggtaggtaggtaggt 19744 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19721 aggtaggtaggtaggtaggt 19740 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19717 aggtaggtaggtaggtaggt 19736 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19713 aggtaggtaggtaggtaggt 19732 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19709 aggtaggtaggtaggtaggt 19728 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19705 aggtaggtaggtaggtaggt 19724 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19701 aggtaggtaggtaggtaggt 19720 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19697 aggtaggtaggtaggtaggt 19716 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19693 aggtaggtaggtaggtaggt 19712 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 19649 aggtaggtaggtaggtaggt 19668
>emb|BX908385.10| Zebrafish DNA sequence from clone CH211-282N12 in linkage group 18, complete sequence Length = 139547 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 126818 aggtaggtaggtaggtaggtt 126798
>emb|BX901908.8| Zebrafish DNA sequence from clone DKEY-268B12 in linkage group 4, complete sequence Length = 210697 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 150014 caggtaggtaggtaggtaggt 150034 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 150019 aggtaggtaggtaggtaggt 150038
>emb|BX663502.9| Zebrafish DNA sequence from clone CH211-202C21 in linkage group 18, complete sequence Length = 188674 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 81985 caggtaggtaggtaggtaggt 81965
>emb|BX908748.7| Zebrafish DNA sequence from clone CH211-215D8 in linkage group 18, complete sequence Length = 212425 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 98768 aggtaggtaggtaggtaggtt 98788 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 98764 aggtaggtaggtaggtaggt 98783
>emb|BX465187.7| Zebrafish DNA sequence from clone DKEYP-6C7 in linkage group 20, complete sequence Length = 168640 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 96673 aggtaggtaggtaggtaggtt 96653 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 96677 aggtaggtaggtaggtaggt 96658
>emb|BX322637.7| Zebrafish DNA sequence from clone DKEY-22A1 in linkage group 9, complete sequence Length = 178563 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 159426 aggtaggtaggtaggtaggtt 159446
>gb|AC109224.16| Mus musculus chromosome 5, clone RP23-150I2, complete sequence Length = 202994 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 191622 caggtaggtaggtaggtaggt 191602 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 191617 aggtaggtaggtaggtaggt 191598 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 191613 aggtaggtaggtaggtaggt 191594 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 191609 aggtaggtaggtaggtaggt 191590
>emb|CR388184.33| Zebrafish DNA sequence from clone CH211-261O3 in linkage group 8, complete sequence Length = 180216 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 98777 aggtaggtaggtaggtaggtt 98757 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99282 aggtaggtaggtaggtaggt 99263 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99278 aggtaggtaggtaggtaggt 99259 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99274 aggtaggtaggtaggtaggt 99255 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99270 aggtaggtaggtaggtaggt 99251 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99266 aggtaggtaggtaggtaggt 99247 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99262 aggtaggtaggtaggtaggt 99243 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99258 aggtaggtaggtaggtaggt 99239 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 99254 aggtaggtaggtaggtaggt 99235 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 98789 aggtaggtaggtaggtaggt 98770 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 98785 aggtaggtaggtaggtaggt 98766 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 98781 aggtaggtaggtaggtaggt 98762
>emb|CR769769.7| Zebrafish DNA sequence from clone CH211-190H11 in linkage group 11, complete sequence Length = 160246 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 151830 caggtaggtaggtaggtaggt 151850 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 151839 aggtaggtaggtaggtaggt 151858 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 151835 aggtaggtaggtaggtaggt 151854
>gb|AC007793.1|AC007793 Homo sapiens chromosome 19, cosmid R27949, complete sequence Length = 38569 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 13709 caggtaggtaggtaggtaggt 13689 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 13704 aggtaggtaggtaggtaggt 13685
>emb|CT009676.9| Zebrafish DNA sequence from clone CH73-390A17 in linkage group 14, complete sequence Length = 92398 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 260 cctctcttttgattctgactt 280 ||||||||||||||||||||| Sbjct: 26504 cctctcttttgattctgactt 26484
>gb|AE003624.3| Drosophila melanogaster chromosome 2L, section 33 of 83 of the complete sequence Length = 270771 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 15830 caggtaggtaggtaggtaggt 15810 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 15825 aggtaggtaggtaggtaggt 15806
>gb|AE003587.4| Drosophila melanogaster chromosome 2L, section 4 of 83 of the complete sequence Length = 314549 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 197350 caggtaggtaggtaggtaggt 197370 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 197355 aggtaggtaggtaggtaggt 197374
>gb|AC102548.11| Mus musculus chromosome 19, clone RP23-135H14, complete sequence Length = 227173 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 147825 caggtaggtaggtaggtaggt 147845 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 147854 aggtaggtaggtaggtaggt 147873 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 147850 aggtaggtaggtaggtaggt 147869 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 147846 aggtaggtaggtaggtaggt 147865 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 147842 aggtaggtaggtaggtaggt 147861 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 147838 aggtaggtaggtaggtaggt 147857 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 147834 aggtaggtaggtaggtaggt 147853 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 147830 aggtaggtaggtaggtaggt 147849
>gb|AC151602.4| Mus musculus BAC clone RP23-218K15 from chromosome 7, complete sequence Length = 249504 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 132089 caggtaggtaggtaggtaggt 132069
>emb|AL845435.19| Zebrafish DNA sequence from clone CH211-176G13 in linkage group 10, complete sequence Length = 141424 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 137678 aggtaggtaggtaggtaggtt 137698
>emb|AL021447.3|CEF19B2 Caenorhabditis elegans Cosmid F19B2, complete sequence Length = 38950 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 26729 aggtaggtaggtaggtaggtt 26749 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26829 aggtaggtaggtaggtaggt 26848 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26825 aggtaggtaggtaggtaggt 26844 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26821 aggtaggtaggtaggtaggt 26840 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26817 aggtaggtaggtaggtaggt 26836 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26813 aggtaggtaggtaggtaggt 26832 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26809 aggtaggtaggtaggtaggt 26828 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26805 aggtaggtaggtaggtaggt 26824 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26801 aggtaggtaggtaggtaggt 26820 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26797 aggtaggtaggtaggtaggt 26816 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26793 aggtaggtaggtaggtaggt 26812 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26789 aggtaggtaggtaggtaggt 26808 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26785 aggtaggtaggtaggtaggt 26804 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26725 aggtaggtaggtaggtaggt 26744 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 26721 aggtaggtaggtaggtaggt 26740
>emb|AL032623.1|CEY43F8B Caenorhabditis elegans YAC Y43F8B, complete sequence Length = 101679 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 87022 caggtaggtaggtaggtaggt 87042 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 86753 caggtaggtaggtaggtaggt 86773 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 86384 caggtaggtaggtaggtaggt 86404 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87203 aggtaggtaggtaggtaggt 87222 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87199 aggtaggtaggtaggtaggt 87218 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87195 aggtaggtaggtaggtaggt 87214 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87191 aggtaggtaggtaggtaggt 87210 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87187 aggtaggtaggtaggtaggt 87206 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87183 aggtaggtaggtaggtaggt 87202 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87035 aggtaggtaggtaggtaggt 87054 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87031 aggtaggtaggtaggtaggt 87050 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 87027 aggtaggtaggtaggtaggt 87046 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86902 aggtaggtaggtaggtaggt 86921 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86898 aggtaggtaggtaggtaggt 86917 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86894 aggtaggtaggtaggtaggt 86913 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86890 aggtaggtaggtaggtaggt 86909 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86758 aggtaggtaggtaggtaggt 86777 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86633 aggtaggtaggtaggtaggt 86652 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86629 aggtaggtaggtaggtaggt 86648 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86625 aggtaggtaggtaggtaggt 86644 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86621 aggtaggtaggtaggtaggt 86640 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86617 aggtaggtaggtaggtaggt 86636 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86613 aggtaggtaggtaggtaggt 86632 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86609 aggtaggtaggtaggtaggt 86628 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86605 aggtaggtaggtaggtaggt 86624 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86601 aggtaggtaggtaggtaggt 86620 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86597 aggtaggtaggtaggtaggt 86616 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86593 aggtaggtaggtaggtaggt 86612 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86589 aggtaggtaggtaggtaggt 86608 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86585 aggtaggtaggtaggtaggt 86604 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86581 aggtaggtaggtaggtaggt 86600 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86577 aggtaggtaggtaggtaggt 86596 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86573 aggtaggtaggtaggtaggt 86592 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86569 aggtaggtaggtaggtaggt 86588 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86565 aggtaggtaggtaggtaggt 86584 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86561 aggtaggtaggtaggtaggt 86580 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86557 aggtaggtaggtaggtaggt 86576 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86397 aggtaggtaggtaggtaggt 86416 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86393 aggtaggtaggtaggtaggt 86412 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86389 aggtaggtaggtaggtaggt 86408 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86264 aggtaggtaggtaggtaggt 86283 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86260 aggtaggtaggtaggtaggt 86279 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86256 aggtaggtaggtaggtaggt 86275 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 86252 aggtaggtaggtaggtaggt 86271 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85955 aggtaggtaggtaggtaggt 85974 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85951 aggtaggtaggtaggtaggt 85970
>gb|AC004067.1|AC004067 Homo sapiens chromosome 4 clone B366O24 map 4q25, complete sequence Length = 161326 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 46541 aggtaggtaggtaggtaggtt 46521 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 46601 aggtaggtaggtaggtaggt 46582 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 46597 aggtaggtaggtaggtaggt 46578 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 46593 aggtaggtaggtaggtaggt 46574 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 46589 aggtaggtaggtaggtaggt 46570 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 46585 aggtaggtaggtaggtaggt 46566 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 46581 aggtaggtaggtaggtaggt 46562 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 46577 aggtaggtaggtaggtaggt 46558
>gb|AC005889.1|AC005889 Drosophila melanogaster, chromosome 2L, region 30A3- 30A6, P1 clones DS06958 and DS03097, complete sequence Length = 108924 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 11686 caggtaggtaggtaggtaggt 11666 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 11681 aggtaggtaggtaggtaggt 11662
>gb|AC147744.17| Mus musculus chromosome 18, clone RP23-398N23, complete sequence Length = 201455 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 32 tttattcagaaaatgtattag 52 ||||||||||||||||||||| Sbjct: 27341 tttattcagaaaatgtattag 27361
>emb|Z66519.2|CEB0334 Caenorhabditis elegans Cosmid B0334, complete sequence Length = 41812 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 23740 caggtaggtaggtaggtaggt 23760
>emb|AL132860.1|CEY56A3A Caenorhabditis elegans YAC Y56A3A, complete sequence Length = 169364 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 42378 caggtaggtaggtaggtaggt 42398 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 42387 aggtaggtaggtaggtaggt 42406 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 42383 aggtaggtaggtaggtaggt 42402
>emb|AL121992.24|HSDJ680D5 Human DNA sequence from clone RP4-680D5 on chromosome 1p36.13-36.31 Contains the 3' end of the gene for a novel DnaJ domain-containing protein (KIAA0962, FLJ13743, FLJ12468), the AGMAT gene for agmatine ureohydrolase (agmatinase), a novel gene (FLJ34180), a novel pseudogene similar to Mus musculus ethanol induced 6 (Etohi6), a CD24 antigen (small cell lung carcinoma cluster 4 antigen) (CD24) pseudogene, the gene for DNA-damage inducible protein 2 (DDI2), the RSC1A1 gene for regulatory solute carrier protein family 1 member 1 and the 5' end of the gene for a novel RUN and PH domain-containing protein (KIAA0842), complete sequence Length = 170399 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 140173 caggtaggtaggtaggtaggt 140153 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 140168 aggtaggtaggtaggtaggt 140149 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 140128 aggtaggtaggtaggtaggt 140109 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 140072 aggtaggtaggtaggtaggt 140053 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 139941 aggtaggtaggtaggtaggt 139922
>emb|AL928814.8| Zebrafish DNA sequence from clone CH211-149O12, complete sequence Length = 170669 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 63603 aggtaggtaggtaggtaggtt 63623 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63599 aggtaggtaggtaggtaggt 63618 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63595 aggtaggtaggtaggtaggt 63614 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 63591 aggtaggtaggtaggtaggt 63610
>gb|AC111082.23| Mus musculus chromosome 17, clone RP23-140I9, complete sequence Length = 171550 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 104519 aggtaggtaggtaggtaggtt 104539 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 104515 aggtaggtaggtaggtaggt 104534 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 104511 aggtaggtaggtaggtaggt 104530 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 104507 aggtaggtaggtaggtaggt 104526 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 104503 aggtaggtaggtaggtaggt 104522
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 1729690 caggtaggtaggtaggtaggt 1729710 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 1729699 aggtaggtaggtaggtaggt 1729718 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 1729695 aggtaggtaggtaggtaggt 1729714
>gb|AC139158.3| Mus musculus BAC clone RP24-77I7 from 8, complete sequence Length = 203921 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 66143 aggtaggtaggtaggtaggtt 66163
>gb|AC147185.2| Mus musculus BAC clone RP24-119J12 from 8, complete sequence Length = 164789 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 23898 caggtaggtaggtaggtaggt 23878 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23893 aggtaggtaggtaggtaggt 23874 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23889 aggtaggtaggtaggtaggt 23870 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23885 aggtaggtaggtaggtaggt 23866 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23881 aggtaggtaggtaggtaggt 23862 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23877 aggtaggtaggtaggtaggt 23858 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 23873 aggtaggtaggtaggtaggt 23854
>emb|CT010429.11| Mouse DNA sequence from clone RP23-306H20 on chromosome 17, complete sequence Length = 191390 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 35505 caggtaggtaggtaggtaggt 35485 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 35375 caggtaggtaggtaggtaggt 35355 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35500 aggtaggtaggtaggtaggt 35481 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35496 aggtaggtaggtaggtaggt 35477 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35492 aggtaggtaggtaggtaggt 35473 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35370 aggtaggtaggtaggtaggt 35351 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35366 aggtaggtaggtaggtaggt 35347 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35362 aggtaggtaggtaggtaggt 35343 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35358 aggtaggtaggtaggtaggt 35339 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35354 aggtaggtaggtaggtaggt 35335 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 35350 aggtaggtaggtaggtaggt 35331
>gb|AC136147.4| Mus musculus BAC clone RP23-18B3 from 8, complete sequence Length = 210916 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 85876 aggtaggtaggtaggtaggtt 85896 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85872 aggtaggtaggtaggtaggt 85891 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85868 aggtaggtaggtaggtaggt 85887 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 85864 aggtaggtaggtaggtaggt 85883
>gb|AC132443.3| Mus musculus BAC clone RP23-157C23 from 6, complete sequence Length = 179231 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 102862 aggtaggtaggtaggtaggtt 102842
>gb|AC122318.4| Mus musculus BAC clone RP23-306H2 from 16, complete sequence Length = 207909 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 115464 caggtaggtaggtaggtaggt 115444 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 115459 aggtaggtaggtaggtaggt 115440 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 115455 aggtaggtaggtaggtaggt 115436 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 115451 aggtaggtaggtaggtaggt 115432 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 115447 aggtaggtaggtaggtaggt 115428 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 115443 aggtaggtaggtaggtaggt 115424 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 115439 aggtaggtaggtaggtaggt 115420
>emb|AL805903.12| Mouse DNA sequence from clone RP23-464N23 on chromosome 4, complete sequence Length = 136895 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 30367 caggtaggtaggtaggtaggt 30387 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 70071 aggtaggtaggtaggtaggt 70090 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 70067 aggtaggtaggtaggtaggt 70086 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 70063 aggtaggtaggtaggtaggt 70082 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 70059 aggtaggtaggtaggtaggt 70078 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 30372 aggtaggtaggtaggtaggt 30391
>gb|AC149390.1| Phakopsora pachyrhizi clone JGIAFNA-5B16, complete sequence Length = 36846 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 157 tcaggtaggtaggtaggtagg 177 ||||||||||||||||||||| Sbjct: 36047 tcaggtaggtaggtaggtagg 36027
>gb|AC161238.7| Mus musculus chromosome 19, clone RP24-288C19, complete sequence Length = 193445 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 176939 aggtaggtaggtaggtaggtt 176959 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 155446 aggtaggtaggtaggtaggt 155465
>gb|DP000019.1| Callicebus moloch target 1 genomic scaffold Length = 2105003 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 487950 caggtaggtaggtaggtaggt 487970 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 487963 aggtaggtaggtaggtaggt 487982 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 487959 aggtaggtaggtaggtaggt 487978 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 487955 aggtaggtaggtaggtaggt 487974 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 371053 aggtaggtaggtaggtaggt 371072 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 371049 aggtaggtaggtaggtaggt 371068 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 371045 aggtaggtaggtaggtaggt 371064 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 371041 aggtaggtaggtaggtaggt 371060 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 371037 aggtaggtaggtaggtaggt 371056 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 371033 aggtaggtaggtaggtaggt 371052
>emb|AL935265.4| Zebrafish DNA sequence from clone DKEY-66M24, complete sequence Length = 197137 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 138859 aggtaggtaggtaggtaggtt 138879 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138855 aggtaggtaggtaggtaggt 138874 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138851 aggtaggtaggtaggtaggt 138870 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138847 aggtaggtaggtaggtaggt 138866 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138843 aggtaggtaggtaggtaggt 138862 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138839 aggtaggtaggtaggtaggt 138858 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138835 aggtaggtaggtaggtaggt 138854 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138831 aggtaggtaggtaggtaggt 138850 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138827 aggtaggtaggtaggtaggt 138846 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138823 aggtaggtaggtaggtaggt 138842 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138819 aggtaggtaggtaggtaggt 138838 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138815 aggtaggtaggtaggtaggt 138834 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138811 aggtaggtaggtaggtaggt 138830 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138807 aggtaggtaggtaggtaggt 138826 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138803 aggtaggtaggtaggtaggt 138822 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138799 aggtaggtaggtaggtaggt 138818 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138795 aggtaggtaggtaggtaggt 138814 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 138791 aggtaggtaggtaggtaggt 138810
>gb|AC115008.7| Mus musculus chromosome 3, clone RP24-189F12, complete sequence Length = 154667 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 126694 caggtaggtaggtaggtaggt 126714 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 126707 aggtaggtaggtaggtaggt 126726 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 126703 aggtaggtaggtaggtaggt 126722 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 159 aggtaggtaggtaggtaggt 178 |||||||||||||||||||| Sbjct: 126699 aggtaggtaggtaggtaggt 126718
>gb|AC153605.2| Mus musculus 6 BAC RP23-346H23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 229744 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 159 aggtaggtaggtaggtaggtt 179 ||||||||||||||||||||| Sbjct: 167568 aggtaggtaggtaggtaggtt 167548
>emb|AL732633.6| Mouse DNA sequence from clone RP23-320E20 on chromosome 11, complete sequence Length = 99697 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 158 caggtaggtaggtaggtaggt 178 ||||||||||||||||||||| Sbjct: 92495 caggtaggtaggtaggtaggt 92475 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,361,893 Number of Sequences: 3902068 Number of extensions: 3361893 Number of successful extensions: 125865 Number of sequences better than 10.0: 2222 Number of HSP's better than 10.0 without gapping: 2224 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 102409 Number of HSP's gapped (non-prelim): 20237 length of query: 369 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 347 effective length of database: 17,147,199,772 effective search space: 5950078320884 effective search space used: 5950078320884 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
