ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl38h04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF474072.1| Hordeum vulgare sp. vulgare cultivar Morex BAC cl... 64 4e-07
2gb|AY641412.1| Hordeum vulgare subsp. vulgare retrotransposon Sa... 58 2e-05
3gb|DQ249273.1| Hordeum vulgare subsp. vulgare cultivar Morex BAC... 50 0.005
4gb|AY188331.1| Triticum monococcum DV92 chromosome 5AL BAC 231A1... 50 0.005
5gb|AF474071.1| Hordeum vulgare subsp. vulgare cultivar Morex BAC... 50 0.005
6gb|AY642926.1| Hordeum vulgare BAC CC24_14, complete sequence 50 0.005
7ref|XM_748692.1| Aspergillus fumigatus Af293 hypothetical protei... 46 0.084
8dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 46 0.084
9ref|XM_451285.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A06402g ... 44 0.33
10emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 44 0.33
11gb|AF403130.1| Mus musculus G protein-gated K+ channel subunit 3... 44 0.33
12gb|AC122754.13| Mus musculus chromosome 1, clone RP24-510K10, co... 44 0.33
13gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, c... 44 0.33
14gb|AC154142.24| Mus musculus chromosome 1, clone RP23-187M7, com... 44 0.33
15gb|AY494981.1| Triticum turgidum A genome HMW glutenin A gene lo... 42 1.3
16gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 42 1.3
17gb|AC147120.2| Pan troglodytes BAC clone CH251-531L7 from Y, com... 42 1.3
18gb|AC124749.5| Mus musculus BAC clone RP23-262G23 from chromosom... 42 1.3
19gb|AC142208.3| Homo sapiens chromosome 16 clone XXfos-89260C6, c... 42 1.3
20gb|AC093519.3| Homo sapiens chromosome 16 clone RP11-107C10, com... 42 1.3
21emb|AL023586.1|HS426F10 Human DNA sequence from clone RP3-426F10... 42 1.3
22ref|XM_793840.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.3
23gb|AC091606.8| Mus Musculus Strain C57BL6/J chromosome X BAC, RP... 42 1.3
24gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 42 1.3
25dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 42 1.3
26ref|XM_691004.1| PREDICTED: Danio rerio similar to Retinitis pig... 42 1.3
27gb|AC160938.2| Pan troglodytes BAC clone CH251-901A9 from chromo... 42 1.3
28gb|AC140838.3| Homo sapiens chromosome 16 clone XXfos-84069G6, c... 42 1.3
29gb|AC140540.3| Homo sapiens chromosome 16 clone XXfos-88730H2, c... 42 1.3
30gb|AC013410.5| Homo sapiens BAC clone RP11-495I2 from 2, complet... 42 1.3
31gb|AC073912.38| Homo sapiens 12 BAC RP11-989F5 (Roswell Park Can... 42 1.3
32emb|AL732294.18| Mouse DNA sequence from clone RP23-59N7 on chro... 42 1.3
33gb|AC161006.2| Pan troglodytes BAC clone CH251-842O13 from chrom... 42 1.3
34emb|BX842684.4| Zebrafish DNA sequence from clone DKEY-33I22 in ... 42 1.3
35gb|AC163729.5| Pan troglodytes BAC clone CH251-1018P19 from chro... 42 1.3
36emb|AL390254.6|CNS06C7M Human chromosome 14 DNA sequence BAC R-9... 42 1.3
37gb|AC110553.10| Mus musculus chromosome 3, clone RP23-248D8, com... 40 5.2
38gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones B... 40 5.2
39gb|AC159381.10| Mus musculus 6 BAC RP24-460E4 (Roswell Park Canc... 40 5.2
40gb|AC161434.2| Mus musculus chromosome 3, clone RP23-7K18, compl... 40 5.2
41gb|AY268139.1| Hordeum vulgare BAC 184G9, complete sequece 40 5.2
42gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosom... 40 5.2
43ref|NM_175251.1| Mus musculus AT rich interactive domain 2 (Arid... 40 5.2
44ref|XM_976812.1| PREDICTED: Mus musculus hypothetical protein LO... 40 5.2
45ref|XM_986969.1| PREDICTED: Mus musculus hypothetical protein LO... 40 5.2
46gb|AC126270.4| Mus musculus BAC clone RP23-233A12 from chromosom... 40 5.2
47gb|AC140436.3| Mus musculus BAC clone RP23-85O2 from chromosome ... 40 5.2
48gb|AC126688.4| Mus musculus BAC clone RP23-152P20 from chromosom... 40 5.2
49ref|XM_854210.1| PREDICTED: Canis familiaris hypothetical protei... 40 5.2
50ref|XM_809221.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 5.2
51gb|AC124352.2| Mus musculus BAC clone RP24-477C23 from chromosom... 40 5.2
52ref|XM_811798.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 5.2
53emb|Z35603.1|CET02C12 Caenorhabditis elegans Cosmid T02C12, comp... 40 5.2
54gb|AC153364.4| Mus musculus BAC clone RP23-35J21 from chromosome... 40 5.2
55emb|CR381640.8| Human DNA sequence from clone RP13-854E9 on chro... 40 5.2
56ref|XM_795396.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 5.2
57gb|AC158769.2| Mus musculus chromosome 15, clone RP23-128J3, com... 40 5.2
58gb|AC127142.3| Rattus norvegicus 4 BAC CH230-41K13 (Children's H... 40 5.2
59gb|AC175313.5| Mus musculus chromosome 5, clone wi1-1204C16, com... 40 5.2
60gb|AC175314.3| Mus musculus chromosome 5, clone wi1-1538A18, com... 40 5.2
61emb|X75564.1|CEMCEIA C.elegans mRNA for myosin IA 40 5.2
62emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 40 5.2
63gb|AC162948.4| Mus musculus BAC clone RP23-14N2 from chromosome ... 40 5.2
64emb|BX640417.1| Bordetella pertussis strain Tohama I, complete g... 40 5.2
65emb|AL645587.9| Mouse DNA sequence from clone RP23-171O15 on chr... 40 5.2
66emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR4... 40 5.2
67emb|AL672181.11| Mouse DNA sequence from clone RP23-223D16 on ch... 40 5.2
68emb|BX004859.8| Human DNA sequence from clone RP13-468P17 on chr... 40 5.2
69gb|AC010067.7| Drosophila melanogaster 3L BAC RP98-10I10 (Roswel... 40 5.2
70gb|AC025871.8| Homo sapiens chromosome 8, clone RP11-181B11, com... 40 5.2
71gb|AC011132.15| Homo sapiens chromosome 8, clone RP11-360M9, com... 40 5.2
72tpg|BK003181.1| TPA: TPA_inf: Drosophila melanogaster HDC19485 (... 40 5.2
73gb|DP000063.1| Oryctolagus cuniculus target 117 genomic scaffold 40 5.2
74ref|NM_080306.2| Drosophila melanogaster pecanex CG3443-RB (pcx)... 40 5.2
75gb|AC104149.6| Drosophila melanogaster X BAC RP98-48O22 (Roswell... 40 5.2
76gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell... 40 5.2
77gb|AC027684.3| Homo sapiens chromosome 16 clone RP11-148F10, com... 40 5.2
78ref|NM_065408.4| Caenorhabditis elegans Heavy chain, Unconventio... 40 5.2
79tpg|BK005742.1| TPA: TPA_exp: Drosophila melanogaster dosage com... 40 5.2
80dbj|AK014481.1| Mus musculus 14 days embryo liver cDNA, RIKEN fu... 40 5.2
81gb|AC012163.13|AC012163 Drosophila melanogaster, chromosome X, r... 40 5.2
82gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 40 5.2
83gb|AC027683.6| Homo sapiens chromosome 16 clone CTD-2357P14, com... 40 5.2
84gb|AC018768.7| Homo sapiens chromosome 16 clone RP11-564M2, comp... 40 5.2
85gb|AC084631.1|CBRG45E19 Caenorhabditis briggsae cosmid G45E19, c... 40 5.2
86gb|AF474982.1| Hordeum vulgare clone BAC 011009, complete sequence 40 5.2
87gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 40 5.2
88dbj|AK173201.1| Mus musculus mRNA for mKIAA1557 protein 40 5.2
89gb|AC133578.12| Mus musculus chromosome 15, clone RP23-212I23, c... 40 5.2
90emb|CT485616.11| Mouse DNA sequence from clone RP23-14H16 on chr... 40 5.2
91gb|AE003507.3| Drosophila melanogaster chromosome X, section 59 ... 40 5.2
92gb|AE003479.3| Drosophila melanogaster chromosome 3L, section 13... 40 5.2
93gb|AE003423.2| Drosophila melanogaster chromosome X, section 7 o... 40 5.2
94gb|AE003419.2| Drosophila melanogaster chromosome X, section 3 o... 40 5.2
95gb|AC146916.3| Rattus norvegicus strain Brown Norway clone CH230... 40 5.2
96gb|AC006075.1|AC006075 Homo sapiens chromosome 16, BAC clone RPC... 40 5.2
97gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1... 40 5.2
98emb|AL845534.7| Mouse DNA sequence from clone RP23-223C17 on chr... 40 5.2
99emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 5.2
100gb|AC140360.4| Mus musculus BAC clone RP24-241G4 from chromosome... 40 5.2
101emb|AL009195.1|DMC30B8 Drosophila melanogaster cosmid clone 30B8 40 5.2
102gb|AC093305.3| Homo sapiens chromosome 5 clone RP11-711G10, comp... 40 5.2
103gb|M74329.1|DROPCXGEN Drosophilia melanogaster pcx gene, 5' end 40 5.2 
>gb|AF474072.1| Hordeum vulgare sp. vulgare cultivar Morex BAC clone 773k14, complete
             sequence
          Length = 113510

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 217   tggtgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagat 272
             ||||||||||||||||| |||||||||||||||| || ||| ||| | ||||||||
Sbjct: 12530 tggtgatgacgatggcgacgatctcccctctccgaagcccataacggactccagat 12475
to top
>gb|AY641412.1| Hordeum vulgare subsp. vulgare retrotransposon Sandra5, complete
            sequence; splicing factor SF2-like protein (SF2) and
            universal stress protein (USP1) genes and Hv
            receptor-kinase-like pseudogene, complete cds; and
            retrotransposons Sandra6 and Sandra7, complete sequence
          Length = 82293

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 220  tgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagat 272
            |||||||||||||  |||| |||||||||||||| ||||||| | ||||||||
Sbjct: 2297 tgatgacgatggccacgatttcccctctccggagcccaaaacggactccagat 2349
to top
>gb|DQ249273.1| Hordeum vulgare subsp. vulgare cultivar Morex BAC 631P8, complete
             sequence
          Length = 101158

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 220   tgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagat 272
             |||||| ||||||| |||| |||||||||||||| || |||| | ||||||||
Sbjct: 98756 tgatgatgatggcgacgatttcccctctccggagcccgaaacggactccagat 98808
to top
>gb|AY188331.1| Triticum monococcum DV92 chromosome 5AL BAC 231A16, complete sequence
          Length = 133625

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                         
Query: 220   tgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagattagctct 279
             |||||||||||||| ||   |||||||||||||| || |||| | |||||||| ||| ||
Sbjct: 32911 tgatgacgatggcgacggattcccctctccggagccccaaacggactccagatcagccct 32970

                  
Query: 280   cccga 284
             |||||
Sbjct: 32971 cccga 32975
to top
>gb|AF474071.1| Hordeum vulgare subsp. vulgare cultivar Morex BAC clone 745c13,
             complete sequence
          Length = 102842

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 360   gggtaaaaataggagccaaagtagggcac 388
             ||||||||||||||||||| |||||||||
Sbjct: 76765 gggtaaaaataggagccaaggtagggcac 76737
to top
>gb|AY642926.1| Hordeum vulgare BAC CC24_14, complete sequence
          Length = 184425

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 220   tgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagat 272
             |||||||||||||| |||| | || ||||||||| ||||||| | ||||||||
Sbjct: 47002 tgatgacgatggcgacgattttccttctccggagcccaaaacggactccagat 47054
to top
>ref|XM_748692.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g08520)
           partial mRNA
          Length = 597

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 212 ggtgatggtgatgacgatggcgg 234
           |||||||||||||||||||||||
Sbjct: 406 ggtgatggtgatgacgatggcgg 384
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 218     ggtgatgacgatggcggcgatct 240
               |||||||||||||||||||||||
Sbjct: 1501550 ggtgatgacgatggcggcgatct 1501572



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 215     gatggtgatgacgatggcggcgat 238
               ||||||| ||||||||||||||||
Sbjct: 4381497 gatggtgttgacgatggcggcgat 4381474
to top
>ref|XM_451285.1| Kluyveromyces lactis NRRL Y-1140, KLLA0A06402g predicted mRNA
          Length = 1968

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 205  atggattggtgatggtgatgac 226
            ||||||||||||||||||||||
Sbjct: 1865 atggattggtgatggtgatgac 1886
to top
>emb|CR382121.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome A of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1062590

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 205    atggattggtgatggtgatgac 226
              ||||||||||||||||||||||
Sbjct: 578193 atggattggtgatggtgatgac 578172
to top
>gb|AF403130.1| Mus musculus G protein-gated K+ channel subunit 3 GIRK3 (Kcnj9) gene,
            complete cds
          Length = 14081

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 213  gtgatggtgatgacgatggcgg 234
            ||||||||||||||||||||||
Sbjct: 5212 gtgatggtgatgacgatggcgg 5233
to top
>gb|AC122754.13| Mus musculus chromosome 1, clone RP24-510K10, complete sequence
          Length = 227950

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 209   attggtgatggtgatgacgatg 230
             ||||||||||||||||||||||
Sbjct: 19181 attggtgatggtgatgacgatg 19202
to top
>gb|DQ267106.1| Triticum urartu clone BAC 210J24 chromosome 4A, complete sequence
          Length = 111912

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 220   tgatgacgatggcggcgatctcccctctccggag 253
             |||||||||||||| ||  |||||||||||||||
Sbjct: 33629 tgatgacgatggcgacggactcccctctccggag 33662
to top
>gb|AC154142.24| Mus musculus chromosome 1, clone RP23-187M7, complete sequence
          Length = 237824

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 209    attggtgatggtgatgacgatg 230
              ||||||||||||||||||||||
Sbjct: 102083 attggtgatggtgatgacgatg 102104
to top
>gb|AY494981.1| Triticum turgidum A genome HMW glutenin A gene locus, sequence
          Length = 307015

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                         
Query: 220   tgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagattagctct 279
             |||||||||||||| ||   |||||||| ||||| || |||||| ||| |||| ||| ||
Sbjct: 82243 tgatgacgatggcgacggattcccctcttcggagccccaaacagactctagatcagccct 82302

                  
Query: 280   cccga 284
             |||||
Sbjct: 82303 cccga 82307
to top
>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
              SNF2P genes, complete cds; nucellin pseudogene, complete
              sequence; putative transposase, phosphatidylinositol
              phosphatidylcholine transfer protein sec14 cytosolic-like
              protein, and phytochrome P450-like protein genes, complete
              cds; and unknown genes
          Length = 438828

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                          
Query: 220    tgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagattagctct 279
              |||||||||||||| ||   |||||||||||||| ||  ||| | |||||||| ||| ||
Sbjct: 145235 tgatgacgatggcgacggattcccctctccggagccccgaacggactccagatcagccct 145294

                   
Query: 280    cccga 284
              |||||
Sbjct: 145295 cccga 145299
to top
>gb|AC147120.2| Pan troglodytes BAC clone CH251-531L7 from Y, complete sequence
          Length = 175034

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 71423 tggtgatggtgatgacgatgg 71443
to top
>gb|AC124749.5| Mus musculus BAC clone RP23-262G23 from chromosome 5, complete sequence
          Length = 209986

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 94305 tggtgatggtgatgacgatgg 94325
to top
>gb|AC142208.3| Homo sapiens chromosome 16 clone XXfos-89260C6, complete sequence
          Length = 37483

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 13277 tggtgatggtgatgacgatgg 13257



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 13124 tggtgatggtgatgacgatgg 13104
to top
>gb|AC093519.3| Homo sapiens chromosome 16 clone RP11-107C10, complete sequence
          Length = 165074

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    tggtgatggtgatgacgatgg 231
              |||||||||||||||||||||
Sbjct: 111714 tggtgatggtgatgacgatgg 111694



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 210    ttggtgatggtgatgacgat 229
              ||||||||||||||||||||
Sbjct: 120719 ttggtgatggtgatgacgat 120738
to top
>emb|AL023586.1|HS426F10 Human DNA sequence from clone RP3-426F10 on chromosome 1p36.21-36.33
             Contains 3' end of the gene for the transmembrane protein
             SHREW1, complete sequence
          Length = 91640

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 182   gtgggagaagccatggaagga 202
             |||||||||||||||||||||
Sbjct: 26003 gtgggagaagccatggaagga 25983
to top
>ref|XM_793840.1| PREDICTED: Strongylocentrotus purpuratus similar to Multidrug
            resistance-associated protein 5 (LOC594398), partial mRNA
          Length = 3277

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 208  gattggtgatggtgatgacga 228
            |||||||||||||||||||||
Sbjct: 2926 gattggtgatggtgatgacga 2906
to top
>gb|AC091606.8| Mus Musculus Strain C57BL6/J chromosome X BAC, RP23-75P20, complete
             sequence
          Length = 234105

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 75666 tggtgatggtgatgacgatgg 75646
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 211      tggtgatggtgatgacgatgg 231
                |||||||||||||||||||||
Sbjct: 12590500 tggtgatggtgatgacgatgg 12590520



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 211     tggtgatggtgatgacgatgg 231
               |||||||||||||||||||||
Sbjct: 2396883 tggtgatggtgatgacgatgg 2396903
to top
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 215    gatggtgatgacgatggcggcgatc 239
              ||||||||||||||||||| |||||
Sbjct: 775947 gatggtgatgacgatggcgacgatc 775923
to top
>ref|XM_691004.1| PREDICTED: Danio rerio similar to Retinitis pigmentosa 1-like 1
           protein (LOC567707), mRNA
          Length = 9429

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 tggtgatggtgatgacgatgg 231
           |||||||||||||||||||||
Sbjct: 335 tggtgatggtgatgacgatgg 315
to top
>gb|AC160938.2| Pan troglodytes BAC clone CH251-901A9 from chromosome y, complete
              sequence
          Length = 212330

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    tggtgatggtgatgacgatgg 231
              |||||||||||||||||||||
Sbjct: 111903 tggtgatggtgatgacgatgg 111923
to top
>gb|AC140838.3| Homo sapiens chromosome 16 clone XXfos-84069G6, complete sequence
          Length = 40546

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 23523 tggtgatggtgatgacgatgg 23503



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 23370 tggtgatggtgatgacgatgg 23350
to top
>gb|AC140540.3| Homo sapiens chromosome 16 clone XXfos-88730H2, complete sequence
          Length = 38342

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 22241 tggtgatggtgatgacgatgg 22221



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 22088 tggtgatggtgatgacgatgg 22068
to top
>gb|AC013410.5| Homo sapiens BAC clone RP11-495I2 from 2, complete sequence
          Length = 200900

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 60516 tggtgatggtgatgacgatgg 60536
to top
>gb|AC073912.38| Homo sapiens 12 BAC RP11-989F5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 211550

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 66240 tggtgatggtgatgacgatgg 66220
to top
>emb|AL732294.18| Mouse DNA sequence from clone RP23-59N7 on chromosome X, complete
             sequence
          Length = 112893

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 81518 tggtgatggtgatgacgatgg 81498
to top
>gb|AC161006.2| Pan troglodytes BAC clone CH251-842O13 from chromosome y, complete
              sequence
          Length = 201209

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    tggtgatggtgatgacgatgg 231
              |||||||||||||||||||||
Sbjct: 102926 tggtgatggtgatgacgatgg 102906
to top
>emb|BX842684.4| Zebrafish DNA sequence from clone DKEY-33I22 in linkage group 20,
             complete sequence
          Length = 140982

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 43698 tggtgatggtgatgacgatgg 43678
to top
>gb|AC163729.5| Pan troglodytes BAC clone CH251-1018P19 from chromosome y, complete
             sequence
          Length = 196073

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 47816 tggtgatggtgatgacgatgg 47836
to top
>emb|AL390254.6|CNS06C7M Human chromosome 14 DNA sequence BAC R-991C1 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 177792

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   tggtgatggtgatgacgatgg 231
             |||||||||||||||||||||
Sbjct: 33419 tggtgatggtgatgacgatgg 33439
to top
>gb|AC110553.10| Mus musculus chromosome 3, clone RP23-248D8, complete sequence
          Length = 206620

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 2379 tggtgatggtgatgacgatg 2360
to top
>gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones BAC 519K7 and 799C8 hardness
             locus region
          Length = 129099

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 217   tggtgatgacgatggcggcgatctcccc 244
             ||||||||||||||||| |||| |||||
Sbjct: 87970 tggtgatgacgatggcgacgatttcccc 87997
to top
>gb|AC159381.10| Mus musculus 6 BAC RP24-460E4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 211463

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   agaagccatggaaggatgat 206
             ||||||||||||||||||||
Sbjct: 85657 agaagccatggaaggatgat 85676
to top
>gb|AC161434.2| Mus musculus chromosome 3, clone RP23-7K18, complete sequence
          Length = 195815

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 64914 tggtgatggtgatgacgatg 64895
to top
>gb|AY268139.1| Hordeum vulgare BAC 184G9, complete sequece
          Length = 120562

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                      
Query: 217    tggtgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagat 272
              |||||||||||| | || |||| |||||||| ||||| ||| ||| | ||||||||
Sbjct: 100961 tggtgatgacgacgacgacgatttcccctcttcggagcccagaacggactccagat 100906
to top
>gb|AC164703.3| Mus musculus BAC clone RP23-266K19 from chromosome 7, complete sequence
          Length = 238433

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    atctctcccatccccttcac 156
              ||||||||||||||||||||
Sbjct: 227649 atctctcccatccccttcac 227668
to top
>ref|NM_175251.1| Mus musculus AT rich interactive domain 2 (Arid-rfx like) (Arid2),
            mRNA
          Length = 3829

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 212  ggtgatggtgatgacgatgg 231
            ||||||||||||||||||||
Sbjct: 1065 ggtgatggtgatgacgatgg 1046
to top
>ref|XM_976812.1| PREDICTED: Mus musculus hypothetical protein LOC669739 (LOC669739),
           mRNA
          Length = 252

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 211 tggtgatggtgatgacgatg 230
           ||||||||||||||||||||
Sbjct: 213 tggtgatggtgatgacgatg 232
to top
>ref|XM_986969.1| PREDICTED: Mus musculus hypothetical protein LOC666910 (LOC666910),
           mRNA
          Length = 252

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 211 tggtgatggtgatgacgatg 230
           ||||||||||||||||||||
Sbjct: 213 tggtgatggtgatgacgatg 232
to top
>gb|AC126270.4| Mus musculus BAC clone RP23-233A12 from chromosome 10, complete
             sequence
          Length = 208709

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 28065 tggtgatggtgatgacgatg 28046
to top
>gb|AC140436.3| Mus musculus BAC clone RP23-85O2 from chromosome 9, complete sequence
          Length = 142560

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 117630 tggtgatggtgatgacgatg 117611
to top
>gb|AC126688.4| Mus musculus BAC clone RP23-152P20 from chromosome 7, complete sequence
          Length = 205673

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 85140 tggtgatggtgatgacgatg 85159
to top
>ref|XM_854210.1| PREDICTED: Canis familiaris hypothetical protein LOC607734
           (LOC607734), mRNA
          Length = 1179

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tggtgatggtgatgacgatg 230
           ||||||||||||||||||||
Sbjct: 271 tggtgatggtgatgacgatg 252



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tggtgatggtgatgacgatg 230
           ||||||||||||||||||||
Sbjct: 151 tggtgatggtgatgacgatg 132
to top
>ref|XM_809221.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053507709.120) partial mRNA
          Length = 4065

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 214 tgatggtgatgacgatggcg 233
           ||||||||||||||||||||
Sbjct: 357 tgatggtgatgacgatggcg 376
to top
>gb|AC124352.2| Mus musculus BAC clone RP24-477C23 from chromosome 9, complete sequence
          Length = 177886

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 153249 tggtgatggtgatgacgatg 153230
to top
>ref|XM_811798.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506577.150) partial mRNA
          Length = 4065

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 214 tgatggtgatgacgatggcg 233
           ||||||||||||||||||||
Sbjct: 354 tgatggtgatgacgatggcg 373
to top
>emb|Z35603.1|CET02C12 Caenorhabditis elegans Cosmid T02C12, complete sequence
          Length = 22800

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 139  ctctcccatccccttcacct 158
            ||||||||||||||||||||
Sbjct: 9688 ctctcccatccccttcacct 9669
to top
>gb|AC153364.4| Mus musculus BAC clone RP23-35J21 from chromosome 10, complete sequence
          Length = 231668

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 172908 tggtgatggtgatgacgatg 172889
to top
>emb|CR381640.8| Human DNA sequence from clone RP13-854E9 on chromosome X, complete
             sequence
          Length = 63682

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 18786 tggtgatggtgatgacgatg 18805
to top
>ref|XM_795396.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
            LOC588132 (LOC588132), mRNA
          Length = 1076

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 1045 tggtgatggtgatgacgatg 1026
to top
>gb|AC158769.2| Mus musculus chromosome 15, clone RP23-128J3, complete sequence
          Length = 199472

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    ggtgatggtgatgacgatgg 231
              ||||||||||||||||||||
Sbjct: 197684 ggtgatggtgatgacgatgg 197703
to top
>gb|AC127142.3| Rattus norvegicus 4 BAC CH230-41K13 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 238669

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 186   gagaagccatggaaggatgatgga 209
             |||||||||||| |||||||||||
Sbjct: 76796 gagaagccatggcaggatgatgga 76773
to top
>gb|AC175313.5| Mus musculus chromosome 5, clone wi1-1204C16, complete sequence
          Length = 38414

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 177   cacatgtgggagaagccatggaag 200
             |||||||| |||||||||||||||
Sbjct: 30951 cacatgtgagagaagccatggaag 30928
to top
>gb|AC175314.3| Mus musculus chromosome 5, clone wi1-1538A18, complete sequence
          Length = 38195

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 177   cacatgtgggagaagccatggaag 200
             |||||||| |||||||||||||||
Sbjct: 25817 cacatgtgagagaagccatggaag 25840
to top
>emb|X75564.1|CEMCEIA C.elegans mRNA for myosin IA
          Length = 3363

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 139  ctctcccatccccttcacct 158
            ||||||||||||||||||||
Sbjct: 3146 ctctcccatccccttcacct 3165
to top
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16
          Length = 349876

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 217    tggtgatgacgatggcggcgatct 240
              |||||| |||||||||||||||||
Sbjct: 229249 tggtgacgacgatggcggcgatct 229226
to top
>gb|AC162948.4| Mus musculus BAC clone RP23-14N2 from chromosome 9, complete sequence
          Length = 221791

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 51003 tggtgatggtgatgacgatg 51022
to top
>emb|BX640417.1| Bordetella pertussis strain Tohama I, complete genome; segment 7/12
          Length = 348934

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 217   tggtgatgacgatggcggcgatct 240
             |||||| |||||||||||||||||
Sbjct: 61817 tggtgacgacgatggcggcgatct 61794
to top
>emb|AL645587.9| Mouse DNA sequence from clone RP23-171O15 on chromosome 13 Contains
             part of a novel gene, complete sequence
          Length = 150986

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 136   aatctctcccatccccttca 155
             ||||||||||||||||||||
Sbjct: 62193 aatctctcccatccccttca 62212
to top
>emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR42I17
          Length = 155168

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 6902 tggtgatggtgatgacgatg 6921
to top
>emb|AL672181.11| Mouse DNA sequence from clone RP23-223D16 on chromosome 11, complete
             sequence
          Length = 181460

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 53760 tggtgatggtgatgacgatg 53741
to top
>emb|BX004859.8| Human DNA sequence from clone RP13-468P17 on chromosome X, complete
             sequence
          Length = 63432

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 19399 tggtgatggtgatgacgatg 19418
to top
>gb|AC010067.7| Drosophila melanogaster 3L BAC RP98-10I10 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 179856

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 211   tggtgatggtgatgacgatggcgg 234
             ||||||||||||||| ||||||||
Sbjct: 61457 tggtgatggtgatgatgatggcgg 61480
to top
>gb|AC025871.8| Homo sapiens chromosome 8, clone RP11-181B11, complete sequence
          Length = 172748

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 209   attggtgatggtgatgacgatggc 232
             ||||||||||||||||| ||||||
Sbjct: 37704 attggtgatggtgatgatgatggc 37727
to top
>gb|AC011132.15| Homo sapiens chromosome 8, clone RP11-360M9, complete sequence
          Length = 216334

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 209    attggtgatggtgatgacgatggc 232
              ||||||||||||||||| ||||||
Sbjct: 134759 attggtgatggtgatgatgatggc 134782
to top
>tpg|BK003181.1| TPA: TPA_inf: Drosophila melanogaster HDC19485 (HDC19485) gene,
           complete cds
          Length = 847

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tggtgatggtgatgacgatg 230
           ||||||||||||||||||||
Sbjct: 746 tggtgatggtgatgacgatg 727
to top
>gb|DP000063.1| Oryctolagus cuniculus target 117 genomic scaffold
          Length = 489372

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 236345 tggtgatggtgatgacgatg 236364
to top
>ref|NM_080306.2| Drosophila melanogaster pecanex CG3443-RB (pcx), mRNA
          Length = 11763

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 1526 tggtgatggtgatgacgatg 1507
to top
>gb|AC104149.6| Drosophila melanogaster X BAC RP98-48O22 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 193714

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 60330 tggtgatggtgatgacgatg 60311
to top
>gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179869

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 21739 tggtgatggtgatgacgatg 21758
to top
>gb|AC027684.3| Homo sapiens chromosome 16 clone RP11-148F10, complete sequence
          Length = 187520

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 66     aacaccatactagaggataggcaacatg 93
              |||||||||||||| |||||| ||||||
Sbjct: 163844 aacaccatactagaagataggtaacatg 163817
to top
>ref|NM_065408.4| Caenorhabditis elegans Heavy chain, Unconventional Myosin family
            member (hum-5) (hum-5) mRNA, complete cds
          Length = 3301

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 139  ctctcccatccccttcacct 158
            ||||||||||||||||||||
Sbjct: 3141 ctctcccatccccttcacct 3160
to top
>tpg|BK005742.1| TPA: TPA_exp: Drosophila melanogaster dosage compensation complex
            binding fragment 10, complete sequence
          Length = 8340

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 6834 tggtgatggtgatgacgatg 6815
to top
>dbj|AK014481.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched
            library, clone:4432409D24 product:hypothetical
            Glutamine-rich region containing protein, full insert
            sequence
          Length = 3829

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 212  ggtgatggtgatgacgatgg 231
            ||||||||||||||||||||
Sbjct: 1065 ggtgatggtgatgacgatgg 1046
to top
>gb|AC012163.13|AC012163 Drosophila melanogaster, chromosome X, region 16F-16F, BAC clone
              BACR17D02, complete sequence
          Length = 186748

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 133226 tggtgatggtgatgacgatg 133207
to top
>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold
          Length = 1888123

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 186  gagaagccatggaaggatgatgga 209
            |||||||||||| |||||||||||
Sbjct: 1877 gagaagccatggcaggatgatgga 1900
to top
>gb|AC027683.6| Homo sapiens chromosome 16 clone CTD-2357P14, complete sequence
          Length = 112945

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 8380 tggtgatggtgatgacgatg 8361
to top
>gb|AC018768.7| Homo sapiens chromosome 16 clone RP11-564M2, complete sequence
          Length = 198093

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 66    aacaccatactagaggataggcaacatg 93
             |||||||||||||| |||||| ||||||
Sbjct: 57468 aacaccatactagaagataggtaacatg 57441
to top
>gb|AC084631.1|CBRG45E19 Caenorhabditis briggsae cosmid G45E19, complete sequence
          Length = 40893

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   ctcccatccccttcacctac 160
             ||||||||||||||||||||
Sbjct: 10823 ctcccatccccttcacctac 10804
to top
>gb|AF474982.1| Hordeum vulgare clone BAC 011009, complete sequence
          Length = 77136

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 217   tggtgatgacgatggcggcgatctcccctctccggaggccaaaacagcctccagat 272
             ||||||||| || | || |||| |||||||||||||| ||| ||| | ||||||||
Sbjct: 46517 tggtgatgatgacgacgtcgatttcccctctccggagcccagaacggactccagat 46572
to top
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 217   tggtgatgacgatggcggcgatctcccc 244
             ||||||||||||||||| |||| |||||
Sbjct: 12753 tggtgatgacgatggcgacgatttcccc 12780
to top
>dbj|AK173201.1| Mus musculus mRNA for mKIAA1557 protein
          Length = 3691

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 212 ggtgatggtgatgacgatgg 231
           ||||||||||||||||||||
Sbjct: 927 ggtgatggtgatgacgatgg 908
to top
>gb|AC133578.12| Mus musculus chromosome 15, clone RP23-212I23, complete sequence
          Length = 235230

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   ggtgatggtgatgacgatgg 231
             ||||||||||||||||||||
Sbjct: 47506 ggtgatggtgatgacgatgg 47525
to top
>emb|CT485616.11| Mouse DNA sequence from clone RP23-14H16 on chromosome 17, complete
             sequence
          Length = 163243

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 53756 tggtgatggtgatgacgatg 53775
to top
>gb|AE003507.3| Drosophila melanogaster chromosome X, section 59 of 74 of the complete
              sequence
          Length = 299804

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 188399 tggtgatggtgatgacgatg 188380
to top
>gb|AE003479.3| Drosophila melanogaster chromosome 3L, section 13 of 83 of the complete
             sequence
          Length = 309958

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 211   tggtgatggtgatgacgatggcgg 234
             ||||||||||||||| ||||||||
Sbjct: 47423 tggtgatggtgatgatgatggcgg 47400
to top
>gb|AE003423.2| Drosophila melanogaster chromosome X, section 7 of 74 of the complete
              sequence
          Length = 292830

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 161071 tggtgatggtgatgacgatg 161052
to top
>gb|AE003419.2| Drosophila melanogaster chromosome X, section 3 of 74 of the complete
              sequence
          Length = 306598

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 269520 tggtgatggtgatgacgatg 269539
to top
>gb|AC146916.3| Rattus norvegicus strain Brown Norway clone CH230-206L9, complete
            sequence
          Length = 215015

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 186  gagaagccatggaaggatgatgga 209
            |||||||||||| |||||||||||
Sbjct: 1877 gagaagccatggcaggatgatgga 1900
to top
>gb|AC006075.1|AC006075 Homo sapiens chromosome 16, BAC clone RPCI-11_192K18 , complete
             sequence
          Length = 169765

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 75233 tggtgatggtgatgacgatg 75214
to top
>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    aatctctcccatccccttca 155
              ||||||||||||||||||||
Sbjct: 439064 aatctctcccatccccttca 439045
to top
>emb|AL845534.7| Mouse DNA sequence from clone RP23-223C17 on chromosome 2, complete
             sequence
          Length = 191379

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   tggtgatggtgatgacgatg 230
             ||||||||||||||||||||
Sbjct: 44407 tggtgatggtgatgacgatg 44388
to top
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 96      cccaaaaatctgatgaacta 115
               ||||||||||||||||||||
Sbjct: 2381613 cccaaaaatctgatgaacta 2381632
to top
>gb|AC140360.4| Mus musculus BAC clone RP24-241G4 from chromosome 12, complete sequence
          Length = 181901

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 127661 tggtgatggtgatgacgatg 127642
to top
>emb|AL009195.1|DMC30B8 Drosophila melanogaster cosmid clone 30B8
          Length = 38125

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 4144 tggtgatggtgatgacgatg 4125
to top
>gb|AC093305.3| Homo sapiens chromosome 5 clone RP11-711G10, complete sequence
          Length = 171196

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 211    tggtgatggtgatgacgatg 230
              ||||||||||||||||||||
Sbjct: 113859 tggtgatggtgatgacgatg 113840
to top
>gb|M74329.1|DROPCXGEN Drosophilia melanogaster pcx gene, 5' end
          Length = 17254

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 211  tggtgatggtgatgacgatg 230
            ||||||||||||||||||||
Sbjct: 6802 tggtgatggtgatgacgatg 6783


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,399,613
Number of Sequences: 3902068
Number of extensions: 3399613
Number of successful extensions: 80164
Number of sequences better than 10.0: 103
Number of HSP's better than 10.0 without gapping: 104
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79621
Number of HSP's gapped (non-prelim): 543
length of query: 388
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 366
effective length of database: 17,147,199,772
effective search space: 6275875116552
effective search space used: 6275875116552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top