>gb|AC165327.4| Mus musculus chromosome 19, clone RP24-318N5, complete sequence
          Length = 191038

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   acagtctggttcagtcatcc 122
             ||||||||||||||||||||
Sbjct: 77614 acagtctggttcagtcatcc 77633

>emb|AL445487.8| Human DNA sequence from clone RP11-417L14 on chromosome 9 Contains a
              karyopherin alpha 2 (RAG cohort 1, importin alpha 1)
              (KPNA2) pseudogene, complete sequence
          Length = 112031

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    acagtgagatgctggggaga 185
              ||||||||||||||||||||
Sbjct: 102842 acagtgagatgctggggaga 102823

>emb|AL133387.8| Human DNA sequence from clone RP11-107I14 on chromosome 10 Contains the
              3' end of a novel gene, three novel genes (FLJ34886), the
              5' end of the BTRC gene for beta-transducin repeat
              containing and four CpG islands, complete sequence
          Length = 157912

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 93     tactgaaggtacagtctggt 112
              ||||||||||||||||||||
Sbjct: 111761 tactgaaggtacagtctggt 111742

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    gtcatccgccagctgaagtt 135
              ||||||||||||||||||||
Sbjct: 704487 gtcatccgccagctgaagtt 704468

>gb|AC104816.4| Homo sapiens BAC clone RP11-690I4 from 4, complete sequence
          Length = 169243

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 117    tcatccgccagctgaagttg 136
              ||||||||||||||||||||
Sbjct: 123800 tcatccgccagctgaagttg 123781


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,836,423
Number of Sequences: 3902068
Number of extensions: 1836423
Number of successful extensions: 135976
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 135947
Number of HSP's gapped (non-prelim): 29
length of query: 204
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 182
effective length of database: 17,147,199,772
effective search space: 3120790358504
effective search space used: 3120790358504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)