ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl38f11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chr... 44 0.25
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.25
3dbj|AP003220.6| Oryza sativa (japonica cultivar-group) genomic D... 44 0.25
4gb|AC157560.3| Mus musculus chromosome 15, clone RP24-270I3, com... 42 0.97
5emb|AL392045.9| Human DNA sequence from clone RP13-408A12 on chr... 42 0.97
6emb|BX001025.23| Zebrafish DNA sequence from clone CH211-240D20,... 42 0.97
7gb|AF016680.2| Caenorhabditis elegans cosmid R12A1, complete seq... 40 3.8
8gb|AY113678.1| Scyllarus arctus 28S ribosomal RNA gene, partial ... 40 3.8
9emb|AL592549.7| Human DNA sequence from clone RP11-374B16 on chr... 40 3.8
10gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 40 3.8
11gb|AC087397.10| Homo sapiens chromosome 18, clone RP11-594P16, c... 40 3.8
12gb|AC018972.6| Homo sapiens chromosome 18, clone RP11-756M1, com... 40 3.8
13emb|BX649538.4| Zebrafish DNA sequence from clone CH211-239N21 i... 40 3.8
14dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.8
15gb|AC006952.6|AC006952 Homo sapiens chromosome 9, clone hRPK.374... 40 3.8
16gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 3.8
17gb|DQ079810.1| Scyllarus arctus voucher KC2159 28S large subunit... 40 3.8

>emb|AL669853.5| Mouse DNA sequence from clone RP23-204F22 on chromosome 11 Contains part
              of the Abca13 gene for ATP-binding cassette sub-family A
              (ABC1) member 13, complete sequence
          Length = 205759

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 17     tctttttattaagatatgaatg 38
              ||||||||||||||||||||||
Sbjct: 102395 tctttttattaagatatgaatg 102416



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 18       ctttttattaagatatgaatgg 39
                ||||||||||||||||||||||
Sbjct: 25175700 ctttttattaagatatgaatgg 25175679



 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 19       tttttattaagatatgaatg 38
                ||||||||||||||||||||
Sbjct: 28278365 tttttattaagatatgaatg 28278384



to top

>dbj|AP003220.6| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBb0035I14
          Length = 117919

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 18    ctttttattaagatatgaatgg 39
             ||||||||||||||||||||||
Sbjct: 41709 ctttttattaagatatgaatgg 41688



to top

>gb|AC157560.3| Mus musculus chromosome 15, clone RP24-270I3, complete sequence
          Length = 157844

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 215   ttacctctaggttgctgcctt 235
             |||||||||||||||||||||
Sbjct: 80430 ttacctctaggttgctgcctt 80410



to top

>emb|AL392045.9| Human DNA sequence from clone RP13-408A12 on chromosome 10, complete
             sequence
          Length = 161933

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 41    aaagcagatacaaaatggcca 61
             |||||||||||||||||||||
Sbjct: 55695 aaagcagatacaaaatggcca 55715



to top

>emb|BX001025.23| Zebrafish DNA sequence from clone CH211-240D20, complete sequence
          Length = 179475

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 2      atccatcataacccatctttttatt 26
              ||||||||||| |||||||||||||
Sbjct: 175593 atccatcataatccatctttttatt 175569



to top

>gb|AF016680.2| Caenorhabditis elegans cosmid R12A1, complete sequence
          Length = 40554

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     catccatcataacccatcttttta 24
             |||||||||||| |||||||||||
Sbjct: 15198 catccatcataatccatcttttta 15175



to top

>gb|AY113678.1| Scyllarus arctus 28S ribosomal RNA gene, partial sequence
          Length = 851

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 222 taggttgctgccttcgctgc 241
           ||||||||||||||||||||
Sbjct: 333 taggttgctgccttcgctgc 352



to top

>emb|AL592549.7| Human DNA sequence from clone RP11-374B16 on chromosome 9, complete
              sequence
          Length = 128613

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 21     tttattaagatatgaatgggaaagcaga 48
              ||||| |||| |||||||||||||||||
Sbjct: 119265 tttatgaagaaatgaatgggaaagcaga 119292



to top

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 229     ctgccttcgctgccagggat 248
               ||||||||||||||||||||
Sbjct: 2666508 ctgccttcgctgccagggat 2666489



to top

>gb|AC087397.10| Homo sapiens chromosome 18, clone RP11-594P16, complete sequence
          Length = 185912

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 35     aatgggaaagcagatacaaaatgg 58
              |||||||||||| |||||||||||
Sbjct: 146355 aatgggaaagcatatacaaaatgg 146378



to top

>gb|AC018972.6| Homo sapiens chromosome 18, clone RP11-756M1, complete sequence
          Length = 160602

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 35    aatgggaaagcagatacaaaatgg 58
             |||||||||||| |||||||||||
Sbjct: 21121 aatgggaaagcatatacaaaatgg 21144



to top

>emb|BX649538.4| Zebrafish DNA sequence from clone CH211-239N21 in linkage group 3,
             complete sequence
          Length = 147441

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    tcacttgtataagtgcagca 90
             ||||||||||||||||||||
Sbjct: 38883 tcacttgtataagtgcagca 38864



to top

>dbj|AP003452.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0478H03
          Length = 167560

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 19     tttttattaagatatgaatg 38
              ||||||||||||||||||||
Sbjct: 112872 tttttattaagatatgaatg 112891



to top

>gb|AC006952.6|AC006952 Homo sapiens chromosome 9, clone hRPK.374_B_16, complete sequence
          Length = 219345

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 21     tttattaagatatgaatgggaaagcaga 48
              ||||| |||| |||||||||||||||||
Sbjct: 170590 tttatgaagaaatgaatgggaaagcaga 170617



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 223     aggttgctgccttcgctgcc 242
               ||||||||||||||||||||
Sbjct: 3990338 aggttgctgccttcgctgcc 3990319



to top

>gb|DQ079810.1| Scyllarus arctus voucher KC2159 28S large subunit ribosomal RNA gene,
            partial sequence
          Length = 2163

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 222  taggttgctgccttcgctgc 241
            ||||||||||||||||||||
Sbjct: 1136 taggttgctgccttcgctgc 1155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,226,174
Number of Sequences: 3902068
Number of extensions: 2226174
Number of successful extensions: 40802
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40760
Number of HSP's gapped (non-prelim): 42
length of query: 294
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 272
effective length of database: 17,147,199,772
effective search space: 4664038337984
effective search space used: 4664038337984
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top