ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl38e03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC093576.3| Homo sapiens chromosome 1 clone RP11-359C24, comp... 42 0.31
2gb|AC110823.5| Mus musculus BAC clone RP24-366C12 from chromosom... 40 1.2
3gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, comple... 40 1.2
4emb|AL157400.8| Human DNA sequence from clone RP11-80H5 on chrom... 40 1.2
5gb|AC150312.2| Mus musculus BAC clone RP23-336M16 from 7, comple... 40 1.2
6gb|AC148975.3| Mus musculus BAC clone RP23-398E10 from 7, comple... 40 1.2
7gb|AC005742.1| Mus musculus chromosome 11, BAC clone CT7-111I18 ... 38 4.9
8gb|BT012972.1| Lycopersicon esculentum clone 114182R, mRNA sequence 38 4.9
9gb|AC164304.2| Mus musculus BAC clone RP23-261B24 from chromosom... 38 4.9
10gb|AC125405.4| Mus musculus BAC clone RP23-29M17 from 14, comple... 38 4.9
11gb|AC018688.9| Homo sapiens BAC clone RP11-462H3 from UL, comple... 38 4.9
12gb|AC084392.1| Mus musculus BAC clone GS1-182G5 from UL, complet... 38 4.9
13gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome 38 4.9
14gb|DQ119824.1| Bean Golden Yellow Mosaic Virus [HomesteadFL] DNA... 38 4.9
15emb|AL353818.1|ATF14L2 Arabidopsis thaliana DNA chromosome 3, BA... 38 4.9
16emb|AL645741.15| Mouse DNA sequence from clone RP23-239O19 on ch... 38 4.9
17dbj|AK094599.1| Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881 38 4.9
18dbj|AP007172.1| Aspergillus oryzae RIB40 genomic DNA, SC206 38 4.9
19dbj|AB219732.1| Kalmia procumbens chloroplast rpl16 gene, intron... 38 4.9
20dbj|AB219731.1| Kalmia procumbens chloroplast rpl16 gene, intron... 38 4.9
21dbj|AB219730.1| Kalmia procumbens chloroplast rpl16 gene, intron... 38 4.9
22dbj|AB219729.1| Kalmia procumbens chloroplast rpl16 gene, intron... 38 4.9
23ref|XM_929878.1| PREDICTED: Homo sapiens similar to zinc finger ... 38 4.9
24dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 38 4.9
25gb|AC097532.3| Homo sapiens BAC clone RP11-725P16 from 2, comple... 38 4.9
26gb|AF463769.1| Mus musculus strain C57BL/6J cytokine gene cluste... 38 4.9
27dbj|AP004461.3| Oryza sativa (japonica cultivar-group) genomic D... 38 4.9
28emb|CR352257.8| Zebrafish DNA sequence from clone CH211-261B21 i... 38 4.9
29dbj|AB247973.1| Kalmia latifolia chloroplast rpl16 gene, intron,... 38 4.9
30dbj|AB247972.1| Kalmia angustifolia chloroplast rpl16 gene, intr... 38 4.9
31dbj|AB247971.1| Kalmia procumbens chloroplast rpl16 gene, intron... 38 4.9
32gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome 38 4.9

>gb|AC093576.3| Homo sapiens chromosome 1 clone RP11-359C24, complete sequence
          Length = 185461

 Score = 42.1 bits (21), Expect = 0.31
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 57     tctataccaaccaaaatatca 77
              |||||||||||||||||||||
Sbjct: 131602 tctataccaaccaaaatatca 131582



to top

>gb|AC110823.5| Mus musculus BAC clone RP24-366C12 from chromosome 7, complete sequence
          Length = 141116

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     aaagaaaaacggtccattta 24
             ||||||||||||||||||||
Sbjct: 42222 aaagaaaaacggtccattta 42203



to top

>gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, complete sequence
          Length = 221903

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     ccaaaatatcacaccaatga 86
              ||||||||||||||||||||
Sbjct: 103131 ccaaaatatcacaccaatga 103112



to top

>emb|AL157400.8| Human DNA sequence from clone RP11-80H5 on chromosome 10 Contains the
             PANK1 gene for pantothenate kinase 1, a pantothenate
             kinase 1 (PANK1) pseudogene, four novel genes, the 5' end
             of the MPHOSPH1 gene for M-phase phosphoprotein 1, a Homo
             sapiens miR-107-precursor-10 micro RNA and two CpG
             islands, complete sequence
          Length = 148396

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 82    aatgaagcttcaggtcattt 101
             ||||||||||||||||||||
Sbjct: 37562 aatgaagcttcaggtcattt 37581



to top

>gb|AC150312.2| Mus musculus BAC clone RP23-336M16 from 7, complete sequence
          Length = 207429

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 5      aaagaaaaacggtccattta 24
              ||||||||||||||||||||
Sbjct: 197196 aaagaaaaacggtccattta 197215



to top

>gb|AC148975.3| Mus musculus BAC clone RP23-398E10 from 7, complete sequence
          Length = 209924

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     aaagaaaaacggtccattta 24
             ||||||||||||||||||||
Sbjct: 31014 aaagaaaaacggtccattta 31033



to top

>gb|AC005742.1| Mus musculus chromosome 11, BAC clone CT7-111I18 (LBNL M01), complete
              sequence
          Length = 159500

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 9      aaaaacggtccatttaatctttg 31
              ||||| |||||||||||||||||
Sbjct: 102904 aaaaatggtccatttaatctttg 102926



to top

>gb|BT012972.1| Lycopersicon esculentum clone 114182R, mRNA sequence
          Length = 2213

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 66   accaaaatatcacaccaat 84
            |||||||||||||||||||
Sbjct: 1838 accaaaatatcacaccaat 1820



to top

>gb|AC164304.2| Mus musculus BAC clone RP23-261B24 from chromosome 14, complete sequence
          Length = 184690

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 59     tataccaaccaaaatatca 77
              |||||||||||||||||||
Sbjct: 154738 tataccaaccaaaatatca 154756



to top

>gb|AC125405.4| Mus musculus BAC clone RP23-29M17 from 14, complete sequence
          Length = 190653

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 59    tataccaaccaaaatatca 77
             |||||||||||||||||||
Sbjct: 17752 tataccaaccaaaatatca 17770



to top

>gb|AC018688.9| Homo sapiens BAC clone RP11-462H3 from UL, complete sequence
          Length = 170204

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    atgaagcttcaggtcattt 101
             |||||||||||||||||||
Sbjct: 72567 atgaagcttcaggtcattt 72585



to top

>gb|AC084392.1| Mus musculus BAC clone GS1-182G5 from UL, complete sequence
          Length = 142732

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 9     aaaaacggtccatttaatctttg 31
             ||||| |||||||||||||||||
Sbjct: 41627 aaaaatggtccatttaatctttg 41649



to top

>gb|CP000300.1| Methanococcoides burtonii DSM 6242, complete genome
          Length = 2575032

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 66      accaaaatatcacaccaat 84
               |||||||||||||||||||
Sbjct: 2260784 accaaaatatcacaccaat 2260766



to top

>gb|DQ119824.1| Bean Golden Yellow Mosaic Virus [HomesteadFL] DNA A, complete
           sequence
          Length = 2645

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 62  accaaccaaaatatcacac 80
           |||||||||||||||||||
Sbjct: 601 accaaccaaaatatcacac 583



to top

>emb|AL353818.1|ATF14L2 Arabidopsis thaliana DNA chromosome 3, BAC clone F14L2
          Length = 107027

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    tttaatctttgtataccca 39
             |||||||||||||||||||
Sbjct: 99403 tttaatctttgtataccca 99385



to top

>emb|AL645741.15| Mouse DNA sequence from clone RP23-239O19 on chromosome 11 Contains the
             Rad50 gene for RAD50 homolog (S. cerevisiae), the Il5 gene
             for interleukin 5, a pseudogene similar to part of
             glyceraldehyde-3-phosphate dehydrogenase (Gapd), a novel
             gene, a ribosomal protein S2 (Rps2) pseudogene, the Il13
             gene for interleukin 13, the 5' end of the Il4 gene for
             interleukin 4 and a CpG island, complete sequence
          Length = 121121

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 9     aaaaacggtccatttaatctttg 31
             ||||| |||||||||||||||||
Sbjct: 16889 aaaaatggtccatttaatctttg 16911



to top

>dbj|AK094599.1| Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881
          Length = 2934

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 83  atgaagcttcaggtcattt 101
           |||||||||||||||||||
Sbjct: 988 atgaagcttcaggtcattt 970



to top

>dbj|AP007172.1| Aspergillus oryzae RIB40 genomic DNA, SC206
          Length = 343979

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 15     ggtccatttaatctttgtatacc 37
              ||||||||| |||||||||||||
Sbjct: 312717 ggtccatttcatctttgtatacc 312695



to top

>dbj|AB219732.1| Kalmia procumbens chloroplast rpl16 gene, intron, partial sequence,
           specimen_voucher:K. Senni  S64 (MAK)
          Length = 954

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  catttaatctttgtatacc 37
           |||||||||||||||||||
Sbjct: 768 catttaatctttgtatacc 750



to top

>dbj|AB219731.1| Kalmia procumbens chloroplast rpl16 gene, intron, partial sequence,
           specimen_voucher:N. Fujii  F01790 (MAK)
          Length = 956

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  catttaatctttgtatacc 37
           |||||||||||||||||||
Sbjct: 770 catttaatctttgtatacc 752



to top

>dbj|AB219730.1| Kalmia procumbens chloroplast rpl16 gene, intron, partial sequence,
           specimen_voucher:K. Senni  S1248 (MAK)
          Length = 955

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  catttaatctttgtatacc 37
           |||||||||||||||||||
Sbjct: 769 catttaatctttgtatacc 751



to top

>dbj|AB219729.1| Kalmia procumbens chloroplast rpl16 gene, intron, partial sequence,
           specimen_voucher:N. Fujii  F01507 (MAK)
          Length = 954

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  catttaatctttgtatacc 37
           |||||||||||||||||||
Sbjct: 768 catttaatctttgtatacc 750



to top

>ref|XM_929878.1| PREDICTED: Homo sapiens similar to zinc finger protein 285
            (LOC646915), mRNA
          Length = 3140

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 83   atgaagcttcaggtcattt 101
            |||||||||||||||||||
Sbjct: 1189 atgaagcttcaggtcattt 1171



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 39      acatgcgggaatcgataat 57
               |||||||||||||||||||
Sbjct: 2908822 acatgcgggaatcgataat 2908804



to top

>gb|AC097532.3| Homo sapiens BAC clone RP11-725P16 from 2, complete sequence
          Length = 190703

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 83     atgaagcttcaggtcattt 101
              |||||||||||||||||||
Sbjct: 126092 atgaagcttcaggtcattt 126074



to top

>gb|AF463769.1| Mus musculus strain C57BL/6J cytokine gene cluster, partial sequence
          Length = 34408

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 9     aaaaacggtccatttaatctttg 31
             ||||| |||||||||||||||||
Sbjct: 11379 aaaaatggtccatttaatctttg 11357



to top

>dbj|AP004461.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0443G08
          Length = 162139

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    acatgcgggaatcgataat 57
             |||||||||||||||||||
Sbjct: 81884 acatgcgggaatcgataat 81866



to top

>emb|CR352257.8| Zebrafish DNA sequence from clone CH211-261B21 in linkage group 7,
              complete sequence
          Length = 159979

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     tttaatctttgtataccca 39
              |||||||||||||||||||
Sbjct: 143384 tttaatctttgtataccca 143402



to top

>dbj|AB247973.1| Kalmia latifolia chloroplast rpl16 gene, intron, partial sequence,
           specimen_voucher: S4921 (Makino Herbarium, Tokyo
           Metropolitan Univ.)
          Length = 952

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  catttaatctttgtatacc 37
           |||||||||||||||||||
Sbjct: 767 catttaatctttgtatacc 749



to top

>dbj|AB247972.1| Kalmia angustifolia chloroplast rpl16 gene, intron, partial
           sequence, specimen_voucher: S4922 (Makino Herbarium,
           Tokyo Metropolitan Univ.)
          Length = 951

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  catttaatctttgtatacc 37
           |||||||||||||||||||
Sbjct: 771 catttaatctttgtatacc 753



to top

>dbj|AB247971.1| Kalmia procumbens chloroplast rpl16 gene, intron, partial sequence,
           specimen_voucher: F9822 (Makino Herbarium, Tokyo
           Metropolitan Univ.)
          Length = 947

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  catttaatctttgtatacc 37
           |||||||||||||||||||
Sbjct: 767 catttaatctttgtatacc 749



to top

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 68      caaaatatcacaccaatga 86
               |||||||||||||||||||
Sbjct: 1826907 caaaatatcacaccaatga 1826925


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,309,163
Number of Sequences: 3902068
Number of extensions: 1309163
Number of successful extensions: 71956
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71868
Number of HSP's gapped (non-prelim): 88
length of query: 108
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 87
effective length of database: 17,151,101,840
effective search space: 1492145860080
effective search space used: 1492145860080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top