ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl38d02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_197161.1| Oryza sativa (japonica cultivar-group) putative... 117 3e-23
2gb|AC068950.11| Oryza sativa chromosome 10 BAC OSJNBa0041P03 gen... 117 3e-23
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 117 3e-23
4gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 117 3e-23
5gb|AC147234.3| Mus musculus BAC clone RP24-500F11 from chromosom... 46 0.088
6gb|AC122211.4| Mus musculus BAC clone RP23-97F18 from chromosome... 46 0.088
7gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 44 0.35
8gb|U23510.3| Caenorhabditis elegans cosmid R12C12, complete sequ... 44 0.35
9gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, co... 42 1.4
10emb|CR685270.1|CNS0FRPE Tetraodon nigroviridis full-length cDNA 42 1.4
11ref|XM_669842.1| Plasmodium berghei strain ANKA hypothetical pro... 42 1.4
12emb|CR653245.1|CNS0F30J Tetraodon nigroviridis full-length cDNA 42 1.4
13emb|CR651556.2|CNS0F1PM Tetraodon nigroviridis full-length cDNA 42 1.4
14gb|AC106019.4| Homo sapiens chromosome 17, clone CTD-2540E3, com... 42 1.4
15gb|AC158391.2| Mus musculus BAC clone RP23-441C8 from chromosome... 40 5.4
16gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 40 5.4
17gb|AC146127.4| Pan troglodytes BAC clone RP43-23F10 from 7, comp... 40 5.4
18ref|NM_198215.2| Homo sapiens family with sequence similarity 13... 40 5.4
19gb|AC005682.2| Homo sapiens BAC clone RP11-84K19 from 7, complet... 40 5.4
20gb|AC116327.4| Mus musculus BAC clone RP24-68L14 from 7, complet... 40 5.4
21gb|AC146483.2| Pan troglodytes BAC clone RP43-30K12 from 7, comp... 40 5.4
22gb|AC069559.27| Mus musculus strain C57BL/6J clone rp23-136j2 ma... 40 5.4
23ref|XM_536357.2| PREDICTED: Canis familiaris similar to phytanoy... 40 5.4
24gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 5.4
25gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 40 5.4
26gb|AC025038.6| Homo sapiens chromosome 10 clone RP11-443O13, com... 40 5.4
27ref|NM_032439.1| Homo sapiens phytanoyl-CoA 2-hydroxylase intera... 40 5.4
28gb|AC105386.3| Homo sapiens BAC clone RP11-153E9 from 4, complet... 40 5.4
29gb|AC009313.4| Homo sapiens BAC clone RP11-440P12 from 2, comple... 40 5.4
30gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 5.4
31emb|BX005235.8| Zebrafish DNA sequence from clone DKEY-68L7 in l... 40 5.4
32gb|BC011268.2| Homo sapiens phytanoyl-CoA 2-hydroxylase interact... 40 5.4
33dbj|AP001972.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 5.4
34gb|AC174772.1| Gasterosteus aculeatus clone VMRC28-84K14, comple... 40 5.4
35gb|AC154349.1| Mus musculus BAC clone RP23-222O19 from 17, compl... 40 5.4
36emb|AL929508.6| Zebrafish DNA sequence from clone CH211-158G13, ... 40 5.4
37emb|AL670771.6| Mouse DNA sequence from clone RP23-256C8 on chro... 40 5.4
38emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chro... 40 5.4
39emb|AL834339.1|HSM805397 Homo sapiens mRNA; cDNA DKFZp761M0113 (... 40 5.4
40dbj|AB058699.1| Homo sapiens mRNA for KIAA1796 protein, partial cds 40 5.4

>ref|NM_197161.1| Oryza sativa (japonica cultivar-group) putative DNA-directed RNA
            polymerase I subunit, 5'-partial (OSJNBa0041P03.1), mRNA
          Length = 3069

 Score =  117 bits (59), Expect = 3e-23
 Identities = 149/179 (83%)
 Strand = Plus / Minus

                                                                        
Query: 212  ttgctcagccggaggtccagctttatgttcatagcagccagctcggctgccagatacctg 271
            ||||| ||||| || |||| |||||||||||| || |||| |||||  ||||| || |||
Sbjct: 3029 ttgctgagccgaagctccaactttatgttcatggccgccaactcggaggccaggtatctg 2970

                                                                        
Query: 272  aagacgtacggcatcgccaccgtctccatccctttgtttgtctggcaggcctggcacgca 331
            |||||||| ||||| || || ||||||||||||||| |||| | |||||||||||| |||
Sbjct: 2969 aagacgtaaggcatggcgacggtctccatccctttgcttgttttgcaggcctggcaggca 2910

                                                                       
Query: 332  aagttcttggtgggtttcaccgtgttgatgcccagcatgtggcgcttggatttcttctg 390
            ||||||||||  ||||| || |||  ||  || ||||||| |||||||| |||||||||
Sbjct: 2909 aagttcttgggaggttttacggtggggagcccgagcatgtcgcgcttggctttcttctg 2851



to top

>gb|AC068950.11| Oryza sativa chromosome 10 BAC OSJNBa0041P03 genomic sequence,
            complete sequence
          Length = 139614

 Score =  117 bits (59), Expect = 3e-23
 Identities = 149/179 (83%)
 Strand = Plus / Minus

                                                                        
Query: 212  ttgctcagccggaggtccagctttatgttcatagcagccagctcggctgccagatacctg 271
            ||||| ||||| || |||| |||||||||||| || |||| |||||  ||||| || |||
Sbjct: 8213 ttgctgagccgaagctccaactttatgttcatggccgccaactcggaggccaggtatctg 8154

                                                                        
Query: 272  aagacgtacggcatcgccaccgtctccatccctttgtttgtctggcaggcctggcacgca 331
            |||||||| ||||| || || ||||||||||||||| |||| | |||||||||||| |||
Sbjct: 8153 aagacgtaaggcatggcgacggtctccatccctttgcttgttttgcaggcctggcaggca 8094

                                                                       
Query: 332  aagttcttggtgggtttcaccgtgttgatgcccagcatgtggcgcttggatttcttctg 390
            ||||||||||  ||||| || |||  ||  || ||||||| |||||||| |||||||||
Sbjct: 8093 aagttcttgggaggttttacggtggggagcccgagcatgtcgcgcttggctttcttctg 8035



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  117 bits (59), Expect = 3e-23
 Identities = 149/179 (83%)
 Strand = Plus / Plus

                                                                            
Query: 212      ttgctcagccggaggtccagctttatgttcatagcagccagctcggctgccagatacctg 271
                ||||| ||||| || |||| |||||||||||| || |||| |||||  ||||| || |||
Sbjct: 18342557 ttgctgagccgaagctccaactttatgttcatggccgccaactcggaggccaggtatctg 18342616

                                                                            
Query: 272      aagacgtacggcatcgccaccgtctccatccctttgtttgtctggcaggcctggcacgca 331
                |||||||| ||||| || || ||||||||||||||| |||| | |||||||||||| |||
Sbjct: 18342617 aagacgtaaggcatggcgacggtctccatccctttgcttgttttgcaggcctggcaggca 18342676

                                                                           
Query: 332      aagttcttggtgggtttcaccgtgttgatgcccagcatgtggcgcttggatttcttctg 390
                ||||||||||  ||||| || |||  ||  || ||||||| |||||||| |||||||||
Sbjct: 18342677 aagttcttgggaggttttacggtggggagcccgagcatgtcgcgcttggctttcttctg 18342735



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  117 bits (59), Expect = 3e-23
 Identities = 149/179 (83%)
 Strand = Plus / Plus

                                                                            
Query: 212      ttgctcagccggaggtccagctttatgttcatagcagccagctcggctgccagatacctg 271
                ||||| ||||| || |||| |||||||||||| || |||| |||||  ||||| || |||
Sbjct: 18352210 ttgctgagccgaagctccaactttatgttcatggccgccaactcggaggccaggtatctg 18352269

                                                                            
Query: 272      aagacgtacggcatcgccaccgtctccatccctttgtttgtctggcaggcctggcacgca 331
                |||||||| ||||| || || ||||||||||||||| |||| | |||||||||||| |||
Sbjct: 18352270 aagacgtaaggcatggcgacggtctccatccctttgcttgttttgcaggcctggcaggca 18352329

                                                                           
Query: 332      aagttcttggtgggtttcaccgtgttgatgcccagcatgtggcgcttggatttcttctg 390
                ||||||||||  ||||| || |||  ||  || ||||||| |||||||| |||||||||
Sbjct: 18352330 aagttcttgggaggttttacggtggggagcccgagcatgtcgcgcttggctttcttctg 18352388



to top

>gb|AC147234.3| Mus musculus BAC clone RP24-500F11 from chromosome 18, complete
             sequence
          Length = 189846

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 104   tctaaacaacatccaaaaatggg 126
             |||||||||||||||||||||||
Sbjct: 24036 tctaaacaacatccaaaaatggg 24014



to top

>gb|AC122211.4| Mus musculus BAC clone RP23-97F18 from chromosome 18, complete sequence
          Length = 186451

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 104   tctaaacaacatccaaaaatggg 126
             |||||||||||||||||||||||
Sbjct: 93421 tctaaacaacatccaaaaatggg 93443



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 280     cggcatcgccaccgtctccatc 301
               ||||||||||||||||||||||
Sbjct: 2190150 cggcatcgccaccgtctccatc 2190171



to top

>gb|U23510.3| Caenorhabditis elegans cosmid R12C12, complete sequence
          Length = 40506

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 198  gagcttctctcatgttgctcag 219
            ||||||||||||||||||||||
Sbjct: 6180 gagcttctctcatgttgctcag 6159



to top

>gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, complete sequence
          Length = 196037

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 74     acaacaatacaacacacaaaa 94
              |||||||||||||||||||||
Sbjct: 189752 acaacaatacaacacacaaaa 189732



to top

>emb|CR685270.1|CNS0FRPE Tetraodon nigroviridis full-length cDNA
          Length = 1315

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 332 aagttcttggtgggtttcacc 352
           |||||||||||||||||||||
Sbjct: 330 aagttcttggtgggtttcacc 350



to top

>ref|XM_669842.1| Plasmodium berghei strain ANKA hypothetical protein
          (PB402342.00.0) partial mRNA
          Length = 129

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 65 ctattttatacaacaatacaa 85
          |||||||||||||||||||||
Sbjct: 30 ctattttatacaacaatacaa 50



to top

>emb|CR653245.1|CNS0F30J Tetraodon nigroviridis full-length cDNA
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 332 aagttcttggtgggtttcacc 352
           |||||||||||||||||||||
Sbjct: 349 aagttcttggtgggtttcacc 369



to top

>emb|CR651556.2|CNS0F1PM Tetraodon nigroviridis full-length cDNA
          Length = 1111

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 332 aagttcttggtgggtttcacc 352
           |||||||||||||||||||||
Sbjct: 348 aagttcttggtgggtttcacc 368



to top

>gb|AC106019.4| Homo sapiens chromosome 17, clone CTD-2540E3, complete sequence
          Length = 59257

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 74    acaacaatacaacacacaaaa 94
             |||||||||||||||||||||
Sbjct: 32556 acaacaatacaacacacaaaa 32536



to top

>gb|AC158391.2| Mus musculus BAC clone RP23-441C8 from chromosome 17, complete
            sequence
          Length = 203548

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 232  ctttatgttcatagcagcca 251
            ||||||||||||||||||||
Sbjct: 1641 ctttatgttcatagcagcca 1660



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 292    cgtctccatccctttgtttg 311
              ||||||||||||||||||||
Sbjct: 398018 cgtctccatccctttgtttg 397999



to top

>gb|AC146127.4| Pan troglodytes BAC clone RP43-23F10 from 7, complete sequence
          Length = 190149

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   tattttatacaacaatacaa 85
            ||||||||||||||||||||
Sbjct: 5536 tattttatacaacaatacaa 5517



to top

>ref|NM_198215.2| Homo sapiens family with sequence similarity 13, member C1 (FAM13C1),
            transcript variant 1, mRNA
          Length = 3379

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 66   tattttatacaacaatacaa 85
            ||||||||||||||||||||
Sbjct: 3334 tattttatacaacaatacaa 3353



to top

>gb|AC005682.2| Homo sapiens BAC clone RP11-84K19 from 7, complete sequence
          Length = 162139

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     tattttatacaacaatacaa 85
              ||||||||||||||||||||
Sbjct: 149713 tattttatacaacaatacaa 149732



to top

>gb|AC116327.4| Mus musculus BAC clone RP24-68L14 from 7, complete sequence
          Length = 194290

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   ctttatgttcatagcagcca 251
             ||||||||||||||||||||
Sbjct: 47894 ctttatgttcatagcagcca 47875



to top

>gb|AC146483.2| Pan troglodytes BAC clone RP43-30K12 from 7, complete sequence
          Length = 208066

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    tattttatacaacaatacaa 85
             ||||||||||||||||||||
Sbjct: 69881 tattttatacaacaatacaa 69862



to top

>gb|AC069559.27| Mus musculus strain C57BL/6J clone rp23-136j2 map 9, complete sequence
          Length = 185365

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 35     agatagtagtacaaggcaaagtaa 58
              |||||||||||||| |||||||||
Sbjct: 132840 agatagtagtacaaagcaaagtaa 132817



to top

>ref|XM_536357.2| PREDICTED: Canis familiaris similar to phytanoyl-CoA hydroxylase
            interacting protein-like (LOC479214), mRNA
          Length = 3224

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   tattttatacaacaatacaa 85
            ||||||||||||||||||||
Sbjct: 1963 tattttatacaacaatacaa 1944



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 196     aggagcttctctcatgttgc 215
               ||||||||||||||||||||
Sbjct: 4442265 aggagcttctctcatgttgc 4442246



to top

>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 248    gccagctcggctgccagata 267
              ||||||||||||||||||||
Sbjct: 562485 gccagctcggctgccagata 562504



to top

>gb|AC025038.6| Homo sapiens chromosome 10 clone RP11-443O13, complete sequence
          Length = 163132

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    tattttatacaacaatacaa 85
             ||||||||||||||||||||
Sbjct: 99776 tattttatacaacaatacaa 99795



to top

>ref|NM_032439.1| Homo sapiens phytanoyl-CoA 2-hydroxylase interacting protein-like
            (PHYHIPL), mRNA
          Length = 3113

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   tattttatacaacaatacaa 85
            ||||||||||||||||||||
Sbjct: 1980 tattttatacaacaatacaa 1961



to top

>gb|AC105386.3| Homo sapiens BAC clone RP11-153E9 from 4, complete sequence
          Length = 35550

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    aatacaacacacaaaatctc 98
             ||||||||||||||||||||
Sbjct: 22603 aatacaacacacaaaatctc 22584



to top

>gb|AC009313.4| Homo sapiens BAC clone RP11-440P12 from 2, complete sequence
          Length = 171881

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 124    gggacgatagatgctctttttcca 147
              |||| |||||||||||||||||||
Sbjct: 102811 gggatgatagatgctctttttcca 102788



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 276     cgtacggcatcgccaccgtc 295
               ||||||||||||||||||||
Sbjct: 1222733 cgtacggcatcgccaccgtc 1222752



to top

>emb|BX005235.8| Zebrafish DNA sequence from clone DKEY-68L7 in linkage group 23, complete
              sequence
          Length = 141636

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 72     atacaacaatacaacacaca 91
              ||||||||||||||||||||
Sbjct: 102606 atacaacaatacaacacaca 102625



to top

>gb|BC011268.2| Homo sapiens phytanoyl-CoA 2-hydroxylase interacting protein-like,
            mRNA (cDNA clone MGC:18231 IMAGE:4156912), complete cds
          Length = 1999

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   tattttatacaacaatacaa 85
            ||||||||||||||||||||
Sbjct: 1818 tattttatacaacaatacaa 1799



to top

>dbj|AP001972.4| Homo sapiens genomic DNA, chromosome 11q, clone:CTD-2562J17, complete
             sequences
          Length = 215225

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 57    aagaatgtctattttataca 76
             ||||||||||||||||||||
Sbjct: 87796 aagaatgtctattttataca 87777



to top

>gb|AC174772.1| Gasterosteus aculeatus clone VMRC28-84K14, complete sequence
          Length = 121286

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 189   tgctgggaggagcttctctc 208
             ||||||||||||||||||||
Sbjct: 82857 tgctgggaggagcttctctc 82876



to top

>gb|AC154349.1| Mus musculus BAC clone RP23-222O19 from 17, complete sequence
          Length = 211677

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   ctttatgttcatagcagcca 251
             ||||||||||||||||||||
Sbjct: 62047 ctttatgttcatagcagcca 62028



to top

>emb|AL929508.6| Zebrafish DNA sequence from clone CH211-158G13, complete sequence
          Length = 180029

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     atacaacaatacaacacaca 91
              ||||||||||||||||||||
Sbjct: 116326 atacaacaatacaacacaca 116307



to top

>emb|AL670771.6| Mouse DNA sequence from clone RP23-256C8 on chromosome X, complete
              sequence
          Length = 219340

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 232    ctttatgttcatagcagcca 251
              ||||||||||||||||||||
Sbjct: 210386 ctttatgttcatagcagcca 210405



to top

>emb|AL732451.8| Mouse DNA sequence from clone RP23-85G19 on chromosome X, complete
              sequence
          Length = 213822

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     ttttatacaacaatacaaca 87
              ||||||||||||||||||||
Sbjct: 197462 ttttatacaacaatacaaca 197443



to top

>emb|AL834339.1|HSM805397 Homo sapiens mRNA; cDNA DKFZp761M0113 (from clone DKFZp761M0113)
          Length = 3113

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   tattttatacaacaatacaa 85
            ||||||||||||||||||||
Sbjct: 1980 tattttatacaacaatacaa 1961



to top

>dbj|AB058699.1| Homo sapiens mRNA for KIAA1796 protein, partial cds
          Length = 4742

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 66   tattttatacaacaatacaa 85
            ||||||||||||||||||||
Sbjct: 1320 tattttatacaacaatacaa 1301


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,656,080
Number of Sequences: 3902068
Number of extensions: 3656080
Number of successful extensions: 231189
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 230914
Number of HSP's gapped (non-prelim): 275
length of query: 405
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 383
effective length of database: 17,147,199,772
effective search space: 6567377512676
effective search space used: 6567377512676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top