ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl38c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC131733.3| Mus musculus BAC clone RP23-98C9 from 8, complete... 44 0.40
2gb|AY359936.1| Trachelomonas grandis large subunit ribosomal RNA... 42 1.6
3gb|AC102611.10| Mus musculus chromosome 1, clone RP23-416O18, co... 42 1.6
4gb|BC054616.1| Danio rerio zgc:64090, mRNA (cDNA clone MGC:64090... 42 1.6
5gb|AC134530.3| Mus musculus BAC clone RP24-507K16 from chromosom... 42 1.6
6gb|AC004848.1| Homo sapiens PAC clone RP4-649P17 from 7, complet... 42 1.6
7emb|AL035413.19|HS657E11 Human DNA sequence from clone RP4-657E1... 42 1.6
8gb|AC158961.3| Mus musculus chromosome 1, clone RP23-316E20, com... 42 1.6
9dbj|AK126387.1| Homo sapiens cDNA FLJ44423 fis, clone UTERU2004929 42 1.6
10ref|XM_680916.1| PREDICTED: Danio rerio skip (LOC572810), mRNA 42 1.6
11ref|NM_200411.1| Danio rerio zgc:64090 (zgc:64090), mRNA 42 1.6
12emb|CT010467.6| Mouse DNA sequence from clone RP23-81C12 on chro... 42 1.6
13ref|XM_528664.1| PREDICTED: Pan troglodytes similar to FLJ14466 ... 40 6.2
14gb|AC129022.5| Mus musculus BAC clone RP23-318P2 from chromosome... 40 6.2
15gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, comp... 40 6.2
16emb|CT025553.4| Mouse DNA sequence from clone RP23-470O20 on chr... 40 6.2
17gb|AC131704.3| Mus musculus BAC clone RP24-149D9 from chromosome... 40 6.2
18gb|AC135780.2| Homo sapiens chromosome 16 clone CTD-2320F3, comp... 40 6.2
19emb|AL355475.7| Human DNA sequence from clone RP1-241M7 on chrom... 40 6.2
20emb|AL162578.13| Human DNA sequence from clone RP11-2J18 on chro... 40 6.2
21gb|AC140062.11| Homo sapiens 12 BAC RP13-298C8 (Roswell Park Can... 40 6.2
22gb|AC116667.2| Homo sapiens chromosome 16 clone RP11-346C20, com... 40 6.2
23ref|NM_030830.1| Rattus norvegicus leucine zipper protein 1 (Luz... 40 6.2
24gb|AC133798.3| Homo sapiens 12 BAC RP11-552F17 (Roswell Park Can... 40 6.2
25gb|AF181259.1|AF181259 Rattus norvegicus putative transcription ... 40 6.2
26dbj|AB015474.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 6.2
27emb|AL138996.4|CNS01DX1 Human chromosome 14 DNA sequence BAC R-9... 40 6.2
28gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1... 40 6.2
29emb|AL732396.11| Mouse DNA sequence from clone RP23-93M14 on chr... 40 6.2

>gb|AC131733.3| Mus musculus BAC clone RP23-98C9 from 8, complete sequence
          Length = 203486

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 47    aaatcaggaagaaaataacaac 68
             ||||||||||||||||||||||
Sbjct: 94548 aaatcaggaagaaaataacaac 94527



to top

>gb|AY359936.1| Trachelomonas grandis large subunit ribosomal RNA gene, partial
           sequence
          Length = 1448

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 121 agcaactctactcctgagtgc 141
           |||||||||||||||||||||
Sbjct: 306 agcaactctactcctgagtgc 286



to top

>gb|AC102611.10| Mus musculus chromosome 1, clone RP23-416O18, complete sequence
          Length = 210808

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 193    tgtgaagtgtttcacgcattt 213
              |||||||||||||||||||||
Sbjct: 139769 tgtgaagtgtttcacgcattt 139749



to top

>gb|BC054616.1| Danio rerio zgc:64090, mRNA (cDNA clone MGC:64090 IMAGE:6794879),
           complete cds
          Length = 2782

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 312 tctccagcgcacaggaagggagtgg 336
           ||||||||||||||||||| |||||
Sbjct: 375 tctccagcgcacaggaaggaagtgg 399



to top

>gb|AC134530.3| Mus musculus BAC clone RP24-507K16 from chromosome 5, complete sequence
          Length = 215112

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 355   gcaacatgatcaacttatcac 375
             |||||||||||||||||||||
Sbjct: 59108 gcaacatgatcaacttatcac 59088



to top

>gb|AC004848.1| Homo sapiens PAC clone RP4-649P17 from 7, complete sequence
          Length = 135214

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 138   gtgcaataaacataacacctccatc 162
             ||||||||||||||||| |||||||
Sbjct: 64724 gtgcaataaacataacatctccatc 64700



to top

>emb|AL035413.19|HS657E11 Human DNA sequence from clone RP4-657E11 on chromosome 1p35.1-36.23
              Contains the 5' end of a novel gene, the C1orf33 gene for
              chromosome 1 open reading frame 33, four novel genes, the
              AKR7A3 gene for aldo-keto reductase family 7, member A3
              (aflatoxin aldehyde reductase), the  AKR7A2 gene for
              aldo-keto reductase family 7, member A2 (aflatoxin aldehyde
              reductase), the 3' end of the CAPZB gene for capping
              protein (actin filament) muscle Z-line, beta and two CpG
              islands, complete sequence
          Length = 154130

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 436    aggaaagccaatgccttgcca 456
              |||||||||||||||||||||
Sbjct: 116818 aggaaagccaatgccttgcca 116838



to top

>gb|AC158961.3| Mus musculus chromosome 1, clone RP23-316E20, complete sequence
          Length = 202205

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 193    tgtgaagtgtttcacgcattt 213
              |||||||||||||||||||||
Sbjct: 174586 tgtgaagtgtttcacgcattt 174606



to top

>dbj|AK126387.1| Homo sapiens cDNA FLJ44423 fis, clone UTERU2004929
          Length = 2564

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 436  aggaaagccaatgccttgcca 456
            |||||||||||||||||||||
Sbjct: 1628 aggaaagccaatgccttgcca 1608



to top

>ref|XM_680916.1| PREDICTED: Danio rerio skip (LOC572810), mRNA
          Length = 567

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 312 tctccagcgcacaggaagggagtgg 336
           ||||||||||||||||||| |||||
Sbjct: 308 tctccagcgcacaggaaggaagtgg 332



to top

>ref|NM_200411.1| Danio rerio zgc:64090 (zgc:64090), mRNA
          Length = 2782

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 312 tctccagcgcacaggaagggagtgg 336
           ||||||||||||||||||| |||||
Sbjct: 375 tctccagcgcacaggaaggaagtgg 399



to top

>emb|CT010467.6| Mouse DNA sequence from clone RP23-81C12 on chromosome 17, complete
             sequence
          Length = 216559

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 52    aggaagaaaataacaacaaaa 72
             |||||||||||||||||||||
Sbjct: 79396 aggaagaaaataacaacaaaa 79416



to top

>ref|XM_528664.1| PREDICTED: Pan troglodytes similar to FLJ14466 protein (LOC473293),
           mRNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 283 cgaggtcaccaggggcatgc 302
           ||||||||||||||||||||
Sbjct: 511 cgaggtcaccaggggcatgc 492



to top

>gb|AC129022.5| Mus musculus BAC clone RP23-318P2 from chromosome 12, complete sequence
          Length = 206083

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 52     aggaagaaaataacaacaaa 71
              ||||||||||||||||||||
Sbjct: 192791 aggaagaaaataacaacaaa 192772



to top

>gb|AC166776.6| Mus musculus chromosome 5, clone RP23-24K16, complete sequence
          Length = 216652

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     tacaagaaatcaggaagaaa 60
              ||||||||||||||||||||
Sbjct: 133911 tacaagaaatcaggaagaaa 133930



to top

>emb|CT025553.4| Mouse DNA sequence from clone RP23-470O20 on chromosome 14, complete
             sequence
          Length = 173093

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    gaagaaaataacaacaaaat 73
             ||||||||||||||||||||
Sbjct: 52691 gaagaaaataacaacaaaat 52710



to top

>gb|AC131704.3| Mus musculus BAC clone RP24-149D9 from chromosome 12, complete sequence
          Length = 163959

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     aggaagaaaataacaacaaa 71
              ||||||||||||||||||||
Sbjct: 146989 aggaagaaaataacaacaaa 147008



to top

>gb|AC135780.2| Homo sapiens chromosome 16 clone CTD-2320F3, complete sequence
          Length = 125603

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 53    ggaagaaaataacaacaaaa 72
             ||||||||||||||||||||
Sbjct: 33769 ggaagaaaataacaacaaaa 33788



to top

>emb|AL355475.7| Human DNA sequence from clone RP1-241M7 on chromosome 1q43-44, complete
             sequence
          Length = 84707

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 128   ctactcctgagtgcaataaa 147
             ||||||||||||||||||||
Sbjct: 32634 ctactcctgagtgcaataaa 32653



to top

>emb|AL162578.13| Human DNA sequence from clone RP11-2J18 on chromosome 6 Contains the
            5' end of a ribosomal protein S15a (RPS15A) and part of
            the gene for BRG1-binding protein ELD/OSA1 (p250R
            KIAA1235) (FLJ00253, FLJ22292), complete sequence
          Length = 182823

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 51   caggaagaaaataacaacaaaatc 74
            ||||||||||| ||||||||||||
Sbjct: 2086 caggaagaaaaaaacaacaaaatc 2109



to top

>gb|AC140062.11| Homo sapiens 12 BAC RP13-298C8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 64695

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 283   cgaggtcaccaggggcatgc 302
             ||||||||||||||||||||
Sbjct: 44743 cgaggtcaccaggggcatgc 44724



to top

>gb|AC116667.2| Homo sapiens chromosome 16 clone RP11-346C20, complete sequence
          Length = 156100

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    ggaagaaaataacaacaaaa 72
             ||||||||||||||||||||
Sbjct: 77872 ggaagaaaataacaacaaaa 77853



to top

>ref|NM_030830.1| Rattus norvegicus leucine zipper protein 1 (Luzp1), mRNA
          Length = 10929

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 432  ttggaggaaagccaatgcct 451
            ||||||||||||||||||||
Sbjct: 8105 ttggaggaaagccaatgcct 8124



to top

>gb|AC133798.3| Homo sapiens 12 BAC RP11-552F17 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 20939

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 283  cgaggtcaccaggggcatgc 302
            ||||||||||||||||||||
Sbjct: 1078 cgaggtcaccaggggcatgc 1059



to top

>gb|AF181259.1|AF181259 Rattus norvegicus putative transcription factor LUZP (Luzp) mRNA,
            complete cds
          Length = 10929

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 432  ttggaggaaagccaatgcct 451
            ||||||||||||||||||||
Sbjct: 8105 ttggaggaaagccaatgcct 8124



to top

>dbj|AB015474.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLM24
          Length = 87487

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    aagaaaataacaacaaaatc 74
             ||||||||||||||||||||
Sbjct: 39022 aagaaaataacaacaaaatc 39003



to top

>emb|AL138996.4|CNS01DX1 Human chromosome 14 DNA sequence BAC R-902B17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 184260

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   ggtgtgtggccatgaagtgg 255
             ||||||||||||||||||||
Sbjct: 29648 ggtgtgtggccatgaagtgg 29667



to top

>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 440    aagccaatgccttgccatac 459
              ||||||||||||||||||||
Sbjct: 661649 aagccaatgccttgccatac 661668



to top

>emb|AL732396.11| Mouse DNA sequence from clone RP23-93M14 on chromosome X, complete
              sequence
          Length = 173254

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 55     aagaaaataacaacaaaatc 74
              ||||||||||||||||||||
Sbjct: 163924 aagaaaataacaacaaaatc 163943


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,185,009
Number of Sequences: 3902068
Number of extensions: 4185009
Number of successful extensions: 114144
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 114076
Number of HSP's gapped (non-prelim): 68
length of query: 459
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 437
effective length of database: 17,147,199,772
effective search space: 7493326300364
effective search space used: 7493326300364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top