ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl38c09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_185823.1| Oryza sativa (japonica cultivar-group), mRNA 190 2e-45
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 190 2e-45
3dbj|AP005296.5| Oryza sativa (japonica cultivar-group) genomic D... 190 2e-45
4dbj|AK121078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 190 2e-45
5gb|AC146016.2| Pan troglodytes BAC clone RP43-131D21 from 7, com... 42 1.4
6dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 1.4
7gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 40 5.6
8gb|AC126125.6| Rattus norvegicus 14 BAC CH230-25F8 (Children's H... 40 5.6
9gb|AC145921.3| Pan troglodytes BAC clone RP43-10J15 from 7, comp... 40 5.6
10gb|AC147050.2| Pan troglodytes BAC clone RP43-138F4 from 7, comp... 40 5.6
11gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 40 5.6
12ref|XM_500452.1| Yarrowia lipolytica CLIB122, YALI0B03190g predi... 40 5.6
13emb|AL022068.2|HS167F1 Human DNA sequence from clone RP1-167F1 o... 40 5.6
14emb|AJ717740.1| Hordeum vulgare betaGAL1 gene, tRNA-Pro pseudoge... 40 5.6
15emb|AL844157.5| Mouse DNA sequence from clone RP24-313C24 on chr... 40 5.6
16gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 5.6
17gb|AC148300.3| Pan troglodytes BAC clone CH251-64B13 from chromo... 40 5.6
18gb|AC078841.4|AC078841 Homo sapiens chromosome 7 clone RP11-377H... 40 5.6
19ref|NM_001009912.1| Danio rerio retinol dehydrogenase 12, like (... 40 5.6
20gb|AC083864.2|AC083864 Homo sapiens chromosome 7 clone RP11-196O... 40 5.6
21gb|BC078208.1| Danio rerio retinol dehydrogenase 12, like, mRNA ... 40 5.6
22gb|U47986.1|HIV1U47986 Human immunodeficiency virus type 1 clone... 40 5.6
23emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 40 5.6
24emb|CT476825.1| S.lycopersicum DNA sequence from clone LE_HBa-19... 40 5.6
25gb|AC167717.3| Oryctolagus cuniculus, clone Oryctolagus cuniculu... 40 5.6 
>ref|NM_185823.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4014

 Score =  190 bits (96), Expect = 2e-45
 Identities = 255/308 (82%)
 Strand = Plus / Minus

                                                                        
Query: 108  caaggcggcgacagagctttgattcgccaggaggaggtttcgcctgcggcaggctgatgc 167
            |||||||||||||  ||||||||||||||  ||| |||||| |   | || | |||||| 
Sbjct: 3983 caaggcggcgacaatgctttgattcgccaacaggtggtttcactatcagctgactgatga 3924

                                                                        
Query: 168  gctctcagcatcttcgtgtaatgctcaagggtatgcgcattctcgtccatcttgtcggta 227
            ||||||||||| |||  ||||| |||||| ||||| ||||||||||| ||||||||| | 
Sbjct: 3923 gctctcagcattttcacgtaattctcaagcgtatgtgcattctcgtctatcttgtcgttg 3864

                                                                        
Query: 228  gacattgtatcctcggccaacttcactgcagccacctgcgatatttcaaaattgtcccca 287
            || |  |||||||| |||||||| |||||||||   || ||||  ||||||||||| |||
Sbjct: 3863 gatacagtatcctcagccaacttgactgcagccctttgagatacctcaaaattgtctcca 3804

                                                                        
Query: 288  gcgagctgcacctgacgggcgacatcttctttccccagctgtgttagaactacaagcagg 347
            || ||||||||||||||||||   |||||| | ||||| ||| ||||||| ||||| |||
Sbjct: 3803 gccagctgcacctgacgggcggtttcttctcttcccagttgtattagaaccacaagtagg 3744

                                                                        
Query: 348  cttttaagctccttttgcgctccagtggccagagacatccccttgagatgctccacaagt 407
            |||||||||||  || | || || | || |||||||||||| ||||||||||||||||||
Sbjct: 3743 cttttaagctcagttagagcaccggaggtcagagacatccctttgagatgctccacaagt 3684

                    
Query: 408  gccatctc 415
            ||||||||
Sbjct: 3683 gccatctc 3676
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  190 bits (96), Expect = 2e-45
 Identities = 255/308 (82%)
 Strand = Plus / Minus

                                                                            
Query: 108      caaggcggcgacagagctttgattcgccaggaggaggtttcgcctgcggcaggctgatgc 167
                |||||||||||||  ||||||||||||||  ||| |||||| |   | || | |||||| 
Sbjct: 22517348 caaggcggcgacaatgctttgattcgccaacaggtggtttcactatcagctgactgatga 22517289

                                                                            
Query: 168      gctctcagcatcttcgtgtaatgctcaagggtatgcgcattctcgtccatcttgtcggta 227
                ||||||||||| |||  ||||| |||||| ||||| ||||||||||| ||||||||| | 
Sbjct: 22517288 gctctcagcattttcacgtaattctcaagcgtatgtgcattctcgtctatcttgtcgttg 22517229

                                                                            
Query: 228      gacattgtatcctcggccaacttcactgcagccacctgcgatatttcaaaattgtcccca 287
                || |  |||||||| |||||||| |||||||||   || ||||  ||||||||||| |||
Sbjct: 22517228 gatacagtatcctcagccaacttgactgcagccctttgagatacctcaaaattgtctcca 22517169

                                                                            
Query: 288      gcgagctgcacctgacgggcgacatcttctttccccagctgtgttagaactacaagcagg 347
                || ||||||||||||||||||   |||||| | ||||| ||| ||||||| ||||| |||
Sbjct: 22517168 gccagctgcacctgacgggcggtttcttctcttcccagttgtattagaaccacaagtagg 22517109

                                                                            
Query: 348      cttttaagctccttttgcgctccagtggccagagacatccccttgagatgctccacaagt 407
                |||||||||||  || | || || | || |||||||||||| ||||||||||||||||||
Sbjct: 22517108 cttttaagctcagttagagcaccggaggtcagagacatccctttgagatgctccacaagt 22517049

                        
Query: 408      gccatctc 415
                ||||||||
Sbjct: 22517048 gccatctc 22517041
to top
>dbj|AP005296.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1720_F04
          Length = 105227

 Score =  190 bits (96), Expect = 2e-45
 Identities = 255/308 (82%)
 Strand = Plus / Minus

                                                                         
Query: 108   caaggcggcgacagagctttgattcgccaggaggaggtttcgcctgcggcaggctgatgc 167
             |||||||||||||  ||||||||||||||  ||| |||||| |   | || | |||||| 
Sbjct: 60836 caaggcggcgacaatgctttgattcgccaacaggtggtttcactatcagctgactgatga 60777

                                                                         
Query: 168   gctctcagcatcttcgtgtaatgctcaagggtatgcgcattctcgtccatcttgtcggta 227
             ||||||||||| |||  ||||| |||||| ||||| ||||||||||| ||||||||| | 
Sbjct: 60776 gctctcagcattttcacgtaattctcaagcgtatgtgcattctcgtctatcttgtcgttg 60717

                                                                         
Query: 228   gacattgtatcctcggccaacttcactgcagccacctgcgatatttcaaaattgtcccca 287
             || |  |||||||| |||||||| |||||||||   || ||||  ||||||||||| |||
Sbjct: 60716 gatacagtatcctcagccaacttgactgcagccctttgagatacctcaaaattgtctcca 60657

                                                                         
Query: 288   gcgagctgcacctgacgggcgacatcttctttccccagctgtgttagaactacaagcagg 347
             || ||||||||||||||||||   |||||| | ||||| ||| ||||||| ||||| |||
Sbjct: 60656 gccagctgcacctgacgggcggtttcttctcttcccagttgtattagaaccacaagtagg 60597

                                                                         
Query: 348   cttttaagctccttttgcgctccagtggccagagacatccccttgagatgctccacaagt 407
             |||||||||||  || | || || | || |||||||||||| ||||||||||||||||||
Sbjct: 60596 cttttaagctcagttagagcaccggaggtcagagacatccctttgagatgctccacaagt 60537

                     
Query: 408   gccatctc 415
             ||||||||
Sbjct: 60536 gccatctc 60529
to top
>dbj|AK121078.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023062J19, full
            insert sequence
          Length = 4593

 Score =  190 bits (96), Expect = 2e-45
 Identities = 255/308 (82%)
 Strand = Plus / Minus

                                                                        
Query: 108  caaggcggcgacagagctttgattcgccaggaggaggtttcgcctgcggcaggctgatgc 167
            |||||||||||||  ||||||||||||||  ||| |||||| |   | || | |||||| 
Sbjct: 4125 caaggcggcgacaatgctttgattcgccaacaggtggtttcactatcagctgactgatga 4066

                                                                        
Query: 168  gctctcagcatcttcgtgtaatgctcaagggtatgcgcattctcgtccatcttgtcggta 227
            ||||||||||| |||  ||||| |||||| ||||| ||||||||||| ||||||||| | 
Sbjct: 4065 gctctcagcattttcacgtaattctcaagcgtatgtgcattctcgtctatcttgtcgttg 4006

                                                                        
Query: 228  gacattgtatcctcggccaacttcactgcagccacctgcgatatttcaaaattgtcccca 287
            || |  |||||||| |||||||| |||||||||   || ||||  ||||||||||| |||
Sbjct: 4005 gatacagtatcctcagccaacttgactgcagccctttgagatacctcaaaattgtctcca 3946

                                                                        
Query: 288  gcgagctgcacctgacgggcgacatcttctttccccagctgtgttagaactacaagcagg 347
            || ||||||||||||||||||   |||||| | ||||| ||| ||||||| ||||| |||
Sbjct: 3945 gccagctgcacctgacgggcggtttcttctcttcccagttgtattagaaccacaagtagg 3886

                                                                        
Query: 348  cttttaagctccttttgcgctccagtggccagagacatccccttgagatgctccacaagt 407
            |||||||||||  || | || || | || |||||||||||| ||||||||||||||||||
Sbjct: 3885 cttttaagctcagttagagcaccggaggtcagagacatccctttgagatgctccacaagt 3826

                    
Query: 408  gccatctc 415
            ||||||||
Sbjct: 3825 gccatctc 3818
to top
>gb|AC146016.2| Pan troglodytes BAC clone RP43-131D21 from 7, complete sequence
          Length = 169393

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    attatttcattccaaaataga 67
             |||||||||||||||||||||
Sbjct: 29195 attatttcattccaaaataga 29175
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 10     atcacaccggcgttgttgatc 30
              |||||||||||||||||||||
Sbjct: 643701 atcacaccggcgttgttgatc 643681
to top
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 150     cctgcggcaggctgatgcgc 169
               ||||||||||||||||||||
Sbjct: 2181711 cctgcggcaggctgatgcgc 2181692
to top
>gb|AC126125.6| Rattus norvegicus 14 BAC CH230-25F8 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 223844

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   catcttctttccccagctgt 329
             ||||||||||||||||||||
Sbjct: 88738 catcttctttccccagctgt 88719
to top
>gb|AC145921.3| Pan troglodytes BAC clone RP43-10J15 from 7, complete sequence
          Length = 201403

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 311    atcttctttccccagctgtg 330
              ||||||||||||||||||||
Sbjct: 183737 atcttctttccccagctgtg 183718
to top
>gb|AC147050.2| Pan troglodytes BAC clone RP43-138F4 from 7, complete sequence
          Length = 190626

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   atcttctttccccagctgtg 330
             ||||||||||||||||||||
Sbjct: 36719 atcttctttccccagctgtg 36700
to top
>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 298     cctgacgggcgacatcttct 317
               ||||||||||||||||||||
Sbjct: 1448590 cctgacgggcgacatcttct 1448571
to top
>ref|XM_500452.1| Yarrowia lipolytica CLIB122, YALI0B03190g predicted mRNA
          Length = 903

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 11  tcacaccggcgttgttgatc 30
           ||||||||||||||||||||
Sbjct: 361 tcacaccggcgttgttgatc 342
to top
>emb|AL022068.2|HS167F1 Human DNA sequence from clone RP1-167F1 on chromosome 6p22.1-22.3
              Contains a keratin 18 (KRT18) (CK18,CYK18) pseudogene and a
              novel gene, complete sequence
          Length = 125055

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     aaaatagagttacaaacttg 79
              ||||||||||||||||||||
Sbjct: 103024 aaaatagagttacaaacttg 103043
to top
>emb|AJ717740.1| Hordeum vulgare betaGAL1 gene, tRNA-Pro pseudogene, ORF_1 pseudogene
            and tnp2-like1 gene (partial)
          Length = 10640

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 243  gccaacttcactgcagccacctgc 266
            |||||||||||||||| |||||||
Sbjct: 6527 gccaacttcactgcaggcacctgc 6550
to top
>emb|AL844157.5| Mouse DNA sequence from clone RP24-313C24 on chromosome 4 Contains a
             novel peudogene and a CpG island, complete sequence
          Length = 156075

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 391   tgagatgctccacaagtgcc 410
             ||||||||||||||||||||
Sbjct: 88549 tgagatgctccacaagtgcc 88568
to top
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 290     gagctgcacctgacgggcga 309
               ||||||||||||||||||||
Sbjct: 2917586 gagctgcacctgacgggcga 2917567
to top
>gb|AC148300.3| Pan troglodytes BAC clone CH251-64B13 from chromosome 7, complete
             sequence
          Length = 173568

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   atcttctttccccagctgtg 330
             ||||||||||||||||||||
Sbjct: 36708 atcttctttccccagctgtg 36689
to top
>gb|AC078841.4|AC078841 Homo sapiens chromosome 7 clone RP11-377H23, complete sequence
          Length = 187497

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 311  atcttctttccccagctgtg 330
            ||||||||||||||||||||
Sbjct: 3473 atcttctttccccagctgtg 3492
to top
>ref|NM_001009912.1| Danio rerio retinol dehydrogenase 12, like (rdh12l), mRNA
          Length = 1495

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 10  atcacaccggcgttgttgat 29
           ||||||||||||||||||||
Sbjct: 582 atcacaccggcgttgttgat 563
to top
>gb|AC083864.2|AC083864 Homo sapiens chromosome 7 clone RP11-196O2, complete sequence
          Length = 156064

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   atcttctttccccagctgtg 330
             ||||||||||||||||||||
Sbjct: 92492 atcttctttccccagctgtg 92473
to top
>gb|BC078208.1| Danio rerio retinol dehydrogenase 12, like, mRNA (cDNA clone
           MGC:100754 IMAGE:7139751), complete cds
          Length = 1495

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 10  atcacaccggcgttgttgat 29
           ||||||||||||||||||||
Sbjct: 582 atcacaccggcgttgttgat 563
to top
>gb|U47986.1|HIV1U47986 Human immunodeficiency virus type 1 clone 8 sample IV envelope
           glycoprotein (env) gene, C2-V5 region, partial cds
          Length = 654

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 33  ttccaagtaccagtattatt 52
           ||||||||||||||||||||
Sbjct: 422 ttccaagtaccagtattatt 403
to top
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 11     tcacaccggcgttgttgatc 30
              ||||||||||||||||||||
Sbjct: 470782 tcacaccggcgttgttgatc 470801
to top
>emb|CT476825.1| S.lycopersicum DNA sequence from clone LE_HBa-198L24 on chromosome 4,
              complete sequence
          Length = 160432

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     tccaaaatagagttacaaac 76
              ||||||||||||||||||||
Sbjct: 141236 tccaaaatagagttacaaac 141217
to top
>gb|AC167717.3| Oryctolagus cuniculus, clone Oryctolagus cuniculus-16721157J10,
             complete sequence
          Length = 33881

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   agctgtgttagaactacaag 343
             ||||||||||||||||||||
Sbjct: 13056 agctgtgttagaactacaag 13037


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,730,535
Number of Sequences: 3902068
Number of extensions: 3730535
Number of successful extensions: 59862
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59716
Number of HSP's gapped (non-prelim): 138
length of query: 415
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 393
effective length of database: 17,147,199,772
effective search space: 6738849510396
effective search space used: 6738849510396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top