Clone Information

BLAST Search Result

Clone Name	rbastl38c05
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AY110419.1\| Zea mays CL19897_1 mRNA sequence	228	1e-56
2	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	176	4e-41
3	gb\|AC099739.2\| Oryza sativa (japonica cultivar-group) chromosome...	176	4e-41
4	gb\|AC144426.1\| Oryza sativa (japonica cultivar-group) chromosome...	176	4e-41
5	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	176	4e-41
6	dbj\|AP000615.1\| Oryza sativa (japonica cultivar-group) genomic D...	176	4e-41
7	ref\|XM_493810.1\| Oryza sativa (japonica cultivar-group), predic...	119	9e-24
8	gb\|AC078923.12\| Homo sapiens 12 BAC RP11-699I16 (Roswell Park Ca...	46	0.10
9	gb\|AC147120.2\| Pan troglodytes BAC clone CH251-531L7 from Y, com...	42	1.6
10	gb\|AC147668.2\| Pan troglodytes BAC clone CH251-120D9 from Y, com...	42	1.6
11	gb\|AC147164.2\| Pan troglodytes BAC clone CH251-1H10 from Y, comp...	42	1.6
12	gb\|AC147139.2\| Pan troglodytes BAC clone CH251-327B12 from Y, co...	42	1.6
13	gb\|AC144376.3\| Pan troglodytes BAC clone RP43-53D10 from Y, comp...	42	1.6
14	gb\|AC018898.17\| Homo sapiens 3 BAC RP11-178K17 (Roswell Park Can...	42	1.6
15	gb\|AC147115.4\| Pan troglodytes BAC clone CH251-550P11 from chrom...	42	1.6
16	gb\|DP000054.1\| Pan troglodytes chromosome Y, partial sequence	42	1.6
17	gb\|AC117521.2\| Homo sapiens chromosome 5 clone RP11-1015H3, comp...	42	1.6
18	gb\|AC018992.6\| Homo sapiens chromosome 8, clone RP11-468O2, comp...	42	1.6
19	ref\|XM_938750.1\| PREDICTED: Homo sapiens KIAA0825 protein (KIAA0...	42	1.6
20	ref\|XM_371761.3\| PREDICTED: Homo sapiens similar to KIAA0825 pro...	42	1.6
21	gb\|AC160938.2\| Pan troglodytes BAC clone CH251-901A9 from chromo...	42	1.6
22	gb\|AC010448.7\| Homo sapiens chromosome 5 clone CTD-2237D2, compl...	42	1.6
23	gb\|AC147683.3\| Pan troglodytes BAC clone CH251-430O9 from chromo...	42	1.6
24	gb\|AC068228.8\| Homo sapiens chromosome 8, clone RP11-539E17, com...	42	1.6
25	gb\|AC104430.3\| Homo sapiens chromosome 8 clone RP11-391E1 map 8q...	42	1.6
26	dbj\|BA000019.2\| Nostoc sp. PCC 7120 DNA, complete genome	42	1.6
27	gb\|AC010283.5\|AC010283 Homo sapiens chromosome 5 clone CTC-555J2...	42	1.6
28	emb\|AL928736.5\| Zebrafish DNA sequence from clone CH211-202D20, ...	42	1.6
29	gb\|AC161006.2\| Pan troglodytes BAC clone CH251-842O13 from chrom...	42	1.6
30	gb\|AC163729.5\| Pan troglodytes BAC clone CH251-1018P19 from chro...	42	1.6
31	gb\|AC110544.13\| Mus musculus chromosome 3, clone RP23-112A11, co...	40	6.4
32	ref\|XM_632452.1\| Dictyostelium discoideum hypothetical protein (...	40	6.4
33	gb\|BC100406.1\| Mus musculus similar to Hypothetical protein DJ11...	40	6.4
34	ref\|NM_001034101.1\| Mus musculus similar to Hypothetical protein...	40	6.4
35	ref\|XM_891538.2\| PREDICTED: Mus musculus similar to PRAME family...	40	6.4
36	ref\|XM_285846.6\| PREDICTED: Mus musculus similar to PRAME family...	40	6.4
37	emb\|CR392350.11\| Zebrafish DNA sequence from clone DKEY-61N21 in...	40	6.4
38	gb\|AF545855.1\| Rattus norvegicus cryptochrome 1 mRNA, complete cds	40	6.4
39	emb\|AL035603.11\|HS179E13 Human DNA sequence from clone RP1-179E1...	40	6.4
40	emb\|AL672236.18\| Mouse DNA sequence from clone RP23-206L21 on ch...	40	6.4
41	gb\|AC087865.8\| Homo sapiens 12 BAC RP11-66D24 (Roswell Park Canc...	40	6.4
42	emb\|BX640523.14\| Zebrafish DNA sequence from clone CH211-271E10 ...	40	6.4
43	dbj\|AB234024.1\| Paralichthys olivaceus TLR9 gene for Toll-like r...	40	6.4
44	dbj\|AB234023.1\| Paralichthys olivaceus TLR9 mRNA for Toll-like r...	40	6.4
45	gb\|AC010020.7\| Drosophila melanogaster 3L BAC RP98-26I3 (Roswell...	40	6.4
46	gb\|AC091516.8\| Homo sapiens 12q BAC RP11-474L23 (Roswell Park Ca...	40	6.4
47	emb\|AL928630.15\| Mouse DNA sequence from clone RP23-33P17 on chr...	40	6.4
48	emb\|BX005061.9\| Zebrafish DNA sequence from clone CH211-158F5 in...	40	6.4
49	gb\|AC109638.2\| Homo sapiens BAC clone RP11-495B16 from 2, comple...	40	6.4
50	gb\|AC073606.19\| Homo sapiens 12 BAC RP11-390N6 (Roswell Park Can...	40	6.4
51	gb\|AE003554.3\| Drosophila melanogaster chromosome 3L, section 31...	40	6.4
52	gb\|AC091272.12\| Mus musculus chromosome 1, clone RP23-74B7, comp...	40	6.4
53	emb\|AL954311.13\| Zebrafish DNA sequence from clone CH211-138M12 ...	40	6.4
54	gb\|AE008384.1\| Methanosarcina mazei strain Goe1, complete genome	40	6.4
55	emb\|AL626771.9\| Mouse DNA sequence from clone RP23-281O10 on chr...	40	6.4
56	emb\|X02497.1\|DMCHORSG D.melanogaster chorion genes s18-1, s15-1 ...	40	6.4
57	emb\|X06257.1\|DMS18S15 Drosophila chorion genes s18-1 and s15-1	40	6.4
58	emb\|AL606926.6\| Mouse DNA sequence from clone RP23-231M4 on chro...	40	6.4

>gb|AY110419.1| Zea mays CL19897_1 mRNA sequence
          Length = 712

 Score =  228 bits (115), Expect = 1e-56
 Identities = 217/251 (86%)
 Strand = Plus / Plus

                                                                       
Query: 204 catatgagggtgagctgtagctttgggcggtgaggctgaggctcgaccacttccatatgg 263
           ||||| |||||||| || ||||||||||| ||||||||||| || || || |||||||| 
Sbjct: 271 catatcagggtgagttgcagctttgggcgatgaggctgaggttcaacaacctccatatga 330

                                                                       
Query: 264 atcataacactctgcaacacagcatagcttatgtttgttccaggcttggttactttctgg 323
           ||| | ||| |||| |  | ||||||||| ||||||||||| |||||||||||| |||||
Sbjct: 331 atcctgacagtctggaggatagcatagctgatgtttgttccgggcttggttactctctgg 390

                                                                       
Query: 324 tgcacctcgtctactacccagtcagcccctttgtctcccttcgccgtaagatagatgggg 383
           ||||||||||| || ||||| ||| | |||||||| |||||||  ||||| |||||||| 
Sbjct: 391 tgcacctcgtcaacaacccaatcaccgcctttgtcgcccttcggagtaaggtagatgggc 450

                                                                       
Query: 384 ccttctatgccaaacttcggtacgaagactatgaaaccatttgccttgatctttactatt 443
           ||||||||||||||||| || || || |||||||||||||||||||||||||||||||| 
Sbjct: 451 ccttctatgccaaactttgggacaaatactatgaaaccatttgccttgatctttactatc 510

                      
Query: 444 ctagcttcagt 454
           |||||||||||
Sbjct: 511 ctagcttcagt 521

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  176 bits (89), Expect = 4e-41
 Identities = 170/197 (86%)
 Strand = Plus / Plus

                                                                           
Query: 202     ttcatatgagggtgagctgtagctttgggcggtgaggctgaggctcgaccacttccatat 261
               ||||||| |||||||| || | |||||||||||||||||||||||| ||||| |||||||
Sbjct: 1633178 ttcatatcagggtgagttgcaactttgggcggtgaggctgaggctcaaccacctccatat 1633237

                                                                           
Query: 262     ggatcataacactctgcaacacagcatagcttatgtttgttccaggcttggttactttct 321
               | ||||||||  ||||||  ||||| || || | |||||| || |||||||||||| |||
Sbjct: 1633238 gaatcataacggtctgcaggacagcgtaactgacgtttgtcccgggcttggttactctct 1633297

                                                                           
Query: 322     ggtgcacctcgtctactacccagtcagcccctttgtctcccttcgccgtaagatagatgg 381
               |||||||||| ||||||||||| ||| |||| ||||||||||| |  ||||| |||||||
Sbjct: 1633298 ggtgcacctcatctactacccaatcaccccccttgtctccctttggagtaaggtagatgg 1633357

                                
Query: 382     ggccttctatgccaaac 398
               | |||||||||||||||
Sbjct: 1633358 gcccttctatgccaaac 1633374



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                                
Query: 411     actatgaaaccatttgccttgatctttactattctagcttcagtatcca 459
               ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 1633637 actatgaaaccatttgccttgatctttacaattctagcttcagtgtcca 1633685

to top

>gb|AC099739.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1528D07,
             complete sequence
          Length = 87592

 Score =  176 bits (89), Expect = 4e-41
 Identities = 170/197 (86%)
 Strand = Plus / Plus

                                                                         
Query: 202   ttcatatgagggtgagctgtagctttgggcggtgaggctgaggctcgaccacttccatat 261
             ||||||| |||||||| || | |||||||||||||||||||||||| ||||| |||||||
Sbjct: 40624 ttcatatcagggtgagttgcaactttgggcggtgaggctgaggctcaaccacctccatat 40683

                                                                         
Query: 262   ggatcataacactctgcaacacagcatagcttatgtttgttccaggcttggttactttct 321
             | ||||||||  ||||||  ||||| || || | |||||| || |||||||||||| |||
Sbjct: 40684 gaatcataacggtctgcaggacagcgtaactgacgtttgtcccgggcttggttactctct 40743

                                                                         
Query: 322   ggtgcacctcgtctactacccagtcagcccctttgtctcccttcgccgtaagatagatgg 381
             |||||||||| ||||||||||| ||| |||| ||||||||||| |  ||||| |||||||
Sbjct: 40744 ggtgcacctcatctactacccaatcaccccccttgtctccctttggagtaaggtagatgg 40803

                              
Query: 382   ggccttctatgccaaac 398
             | |||||||||||||||
Sbjct: 40804 gcccttctatgccaaac 40820



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                              
Query: 411   actatgaaaccatttgccttgatctttactattctagcttcagtatcca 459
             ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 41083 actatgaaaccatttgccttgatctttacaattctagcttcagtgtcca 41131

to top

>gb|AC144426.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1015F07,
              complete sequence
          Length = 127098

 Score =  176 bits (89), Expect = 4e-41
 Identities = 170/197 (86%)
 Strand = Plus / Plus

                                                                          
Query: 202    ttcatatgagggtgagctgtagctttgggcggtgaggctgaggctcgaccacttccatat 261
              ||||||| |||||||| || | |||||||||||||||||||||||| ||||| |||||||
Sbjct: 112739 ttcatatcagggtgagttgcaactttgggcggtgaggctgaggctcaaccacctccatat 112798

                                                                          
Query: 262    ggatcataacactctgcaacacagcatagcttatgtttgttccaggcttggttactttct 321
              | ||||||||  ||||||  ||||| || || | |||||| || |||||||||||| |||
Sbjct: 112799 gaatcataacggtctgcaggacagcgtaactgacgtttgtcccgggcttggttactctct 112858

                                                                          
Query: 322    ggtgcacctcgtctactacccagtcagcccctttgtctcccttcgccgtaagatagatgg 381
              |||||||||| ||||||||||| ||| |||| ||||||||||| |  ||||| |||||||
Sbjct: 112859 ggtgcacctcatctactacccaatcaccccccttgtctccctttggagtaaggtagatgg 112918

                               
Query: 382    ggccttctatgccaaac 398
              | |||||||||||||||
Sbjct: 112919 gcccttctatgccaaac 112935



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                               
Query: 411    actatgaaaccatttgccttgatctttactattctagcttcagtatcca 459
              ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 113198 actatgaaaccatttgccttgatctttacaattctagcttcagtgtcca 113246

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  176 bits (89), Expect = 4e-41
 Identities = 170/197 (86%)
 Strand = Plus / Plus

                                                                           
Query: 202     ttcatatgagggtgagctgtagctttgggcggtgaggctgaggctcgaccacttccatat 261
               ||||||| |||||||| || | |||||||||||||||||||||||| ||||| |||||||
Sbjct: 1633176 ttcatatcagggtgagttgcaactttgggcggtgaggctgaggctcaaccacctccatat 1633235

                                                                           
Query: 262     ggatcataacactctgcaacacagcatagcttatgtttgttccaggcttggttactttct 321
               | ||||||||  ||||||  ||||| || || | |||||| || |||||||||||| |||
Sbjct: 1633236 gaatcataacggtctgcaggacagcgtaactgacgtttgtcccgggcttggttactctct 1633295

                                                                           
Query: 322     ggtgcacctcgtctactacccagtcagcccctttgtctcccttcgccgtaagatagatgg 381
               |||||||||| ||||||||||| ||| |||| ||||||||||| |  ||||| |||||||
Sbjct: 1633296 ggtgcacctcatctactacccaatcaccccccttgtctccctttggagtaaggtagatgg 1633355

                                
Query: 382     ggccttctatgccaaac 398
               | |||||||||||||||
Sbjct: 1633356 gcccttctatgccaaac 1633372



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                                
Query: 411     actatgaaaccatttgccttgatctttactattctagcttcagtatcca 459
               ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 1633635 actatgaaaccatttgccttgatctttacaattctagcttcagtgtcca 1633683

to top

>dbj|AP000615.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
             clone:P0043E01
          Length = 154128

 Score =  176 bits (89), Expect = 4e-41
 Identities = 170/197 (86%)
 Strand = Plus / Plus

                                                                         
Query: 202   ttcatatgagggtgagctgtagctttgggcggtgaggctgaggctcgaccacttccatat 261
             ||||||| |||||||| || | |||||||||||||||||||||||| ||||| |||||||
Sbjct: 45641 ttcatatcagggtgagttgcaactttgggcggtgaggctgaggctcaaccacctccatat 45700

                                                                         
Query: 262   ggatcataacactctgcaacacagcatagcttatgtttgttccaggcttggttactttct 321
             | ||||||||  ||||||  ||||| || || | |||||| || |||||||||||| |||
Sbjct: 45701 gaatcataacggtctgcaggacagcgtaactgacgtttgtcccgggcttggttactctct 45760

                                                                         
Query: 322   ggtgcacctcgtctactacccagtcagcccctttgtctcccttcgccgtaagatagatgg 381
             |||||||||| ||||||||||| ||| |||| ||||||||||| |  ||||| |||||||
Sbjct: 45761 ggtgcacctcatctactacccaatcaccccccttgtctccctttggagtaaggtagatgg 45820

                              
Query: 382   ggccttctatgccaaac 398
             | |||||||||||||||
Sbjct: 45821 gcccttctatgccaaac 45837



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                              
Query: 411   actatgaaaccatttgccttgatctttactattctagcttcagtatcca 459
             ||||||||||||||||||||||||||||| |||||||||||||| ||||
Sbjct: 46100 actatgaaaccatttgccttgatctttacaattctagcttcagtgtcca 46148

to top

>ref|XM_493810.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2727

 Score =  119 bits (60), Expect = 9e-24
 Identities = 123/144 (85%)
 Strand = Plus / Minus

                                                                        
Query: 255  tccatatggatcataacactctgcaacacagcatagcttatgtttgttccaggcttggtt 314
            |||||||| ||||||||  ||||||  ||||| || || | |||||| || |||||||||
Sbjct: 2642 tccatatgaatcataacggtctgcaggacagcgtaactgacgtttgtcccgggcttggtt 2583

                                                                        
Query: 315  actttctggtgcacctcgtctactacccagtcagcccctttgtctcccttcgccgtaaga 374
            ||| ||||||||||||| ||||||||||| ||| |||| ||||||||||| |  ||||| 
Sbjct: 2582 actctctggtgcacctcatctactacccaatcaccccccttgtctccctttggagtaagg 2523

                                    
Query: 375  tagatggggccttctatgccaaac 398
            |||||||| |||||||||||||||
Sbjct: 2522 tagatgggcccttctatgccaaac 2499

to top

>gb|AC078923.12| Homo sapiens 12 BAC RP11-699I16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 152805

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 111   atttgttgaattgaagaatggac 133
             |||||||||||||||||||||||
Sbjct: 25994 atttgttgaattgaagaatggac 25972

to top

>gb|AC147120.2| Pan troglodytes BAC clone CH251-531L7 from Y, complete sequence
          Length = 175034

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 46    gatttttacacagctctgtaaagag 70
             |||||| ||||||||||||||||||
Sbjct: 31817 gattttgacacagctctgtaaagag 31793

to top

>gb|AC147668.2| Pan troglodytes BAC clone CH251-120D9 from Y, complete sequence
          Length = 181148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 46     gatttttacacagctctgtaaagag 70
              |||||| ||||||||||||||||||
Sbjct: 164930 gattttgacacagctctgtaaagag 164906

to top

>gb|AC147164.2| Pan troglodytes BAC clone CH251-1H10 from Y, complete sequence
          Length = 188603

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 46    gatttttacacagctctgtaaagag 70
             |||||| ||||||||||||||||||
Sbjct: 33015 gattttgacacagctctgtaaagag 33039

to top

>gb|AC147139.2| Pan troglodytes BAC clone CH251-327B12 from Y, complete sequence
          Length = 165128

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 46     gatttttacacagctctgtaaagag 70
              |||||| ||||||||||||||||||
Sbjct: 127317 gattttgacacagctctgtaaagag 127293

to top

>gb|AC144376.3| Pan troglodytes BAC clone RP43-53D10 from Y, complete sequence
          Length = 212954

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 46     gatttttacacagctctgtaaagag 70
              |||||| ||||||||||||||||||
Sbjct: 197282 gattttgacacagctctgtaaagag 197258

to top

>gb|AC018898.17| Homo sapiens 3 BAC RP11-178K17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 170606

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 301   ttccaggcttggttactttct 321
             |||||||||||||||||||||
Sbjct: 36496 ttccaggcttggttactttct 36516

to top

>gb|AC147115.4| Pan troglodytes BAC clone CH251-550P11 from chromosome y, complete
             sequence
          Length = 200911

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 46    gatttttacacagctctgtaaagag 70
             |||||| ||||||||||||||||||
Sbjct: 15679 gattttgacacagctctgtaaagag 15703

to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 46       gatttttacacagctctgtaaagag 70
                |||||| ||||||||||||||||||
Sbjct: 12550894 gattttgacacagctctgtaaagag 12550870



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 46       gatttttacacagctctgtaaagag 70
                |||||| ||||||||||||||||||
Sbjct: 11863891 gattttgacacagctctgtaaagag 11863915



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 46      gatttttacacagctctgtaaagag 70
               |||||| ||||||||||||||||||
Sbjct: 2357302 gattttgacacagctctgtaaagag 2357278



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 46      gatttttacacagctctgtaaagag 70
               |||||| ||||||||||||||||||
Sbjct: 1691987 gattttgacacagctctgtaaagag 1692011

to top

>gb|AC117521.2| Homo sapiens chromosome 5 clone RP11-1015H3, complete sequence
          Length = 171405

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 108   aaaatttgttgaattgaagaa 128
             |||||||||||||||||||||
Sbjct: 81595 aaaatttgttgaattgaagaa 81615

to top

>gb|AC018992.6| Homo sapiens chromosome 8, clone RP11-468O2, complete sequence
          Length = 151712

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 109   aaatttgttgaattgaagaat 129
             |||||||||||||||||||||
Sbjct: 45611 aaatttgttgaattgaagaat 45631

to top

>ref|XM_938750.1| PREDICTED: Homo sapiens KIAA0825 protein (KIAA0825), mRNA
          Length = 1863

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 108 aaaatttgttgaattgaagaa 128
           |||||||||||||||||||||
Sbjct: 9   aaaatttgttgaattgaagaa 29

to top

>ref|XM_371761.3| PREDICTED: Homo sapiens similar to KIAA0825 protein (LOC642488),
           mRNA
          Length = 1863

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 108 aaaatttgttgaattgaagaa 128
           |||||||||||||||||||||
Sbjct: 9   aaaatttgttgaattgaagaa 29

to top

>gb|AC160938.2| Pan troglodytes BAC clone CH251-901A9 from chromosome y, complete
             sequence
          Length = 212330

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 46    gatttttacacagctctgtaaagag 70
             |||||| ||||||||||||||||||
Sbjct: 72321 gattttgacacagctctgtaaagag 72297

to top

>gb|AC010448.7| Homo sapiens chromosome 5 clone CTD-2237D2, complete sequence
          Length = 140090

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 108    aaaatttgttgaattgaagaa 128
              |||||||||||||||||||||
Sbjct: 110562 aaaatttgttgaattgaagaa 110542

to top

>gb|AC147683.3| Pan troglodytes BAC clone CH251-430O9 from chromosome y, complete
              sequence
          Length = 176384

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 46     gatttttacacagctctgtaaagag 70
              |||||| ||||||||||||||||||
Sbjct: 138547 gattttgacacagctctgtaaagag 138523

to top

>gb|AC068228.8| Homo sapiens chromosome 8, clone RP11-539E17, complete sequence
          Length = 200622

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 109    aaatttgttgaattgaagaat 129
              |||||||||||||||||||||
Sbjct: 189054 aaatttgttgaattgaagaat 189034

to top

>gb|AC104430.3| Homo sapiens chromosome 8 clone RP11-391E1 map 8q24.2, complete sequence
          Length = 170376

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 109    aaatttgttgaattgaagaat 129
              |||||||||||||||||||||
Sbjct: 127196 aaatttgttgaattgaagaat 127176

to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 33      gcatcaataaagagatttttacaca 57
               |||||||| ||||||||||||||||
Sbjct: 3175824 gcatcaatcaagagatttttacaca 3175800

to top

>gb|AC010283.5|AC010283 Homo sapiens chromosome 5 clone CTC-555J2, complete sequence
          Length = 157896

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 108    aaaatttgttgaattgaagaa 128
              |||||||||||||||||||||
Sbjct: 131151 aaaatttgttgaattgaagaa 131131

to top

>emb|AL928736.5| Zebrafish DNA sequence from clone CH211-202D20, complete sequence
          Length = 186742

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 94    atcataaaatcaccaaaattt 114
             |||||||||||||||||||||
Sbjct: 70944 atcataaaatcaccaaaattt 70964

to top

>gb|AC161006.2| Pan troglodytes BAC clone CH251-842O13 from chromosome y, complete
              sequence
          Length = 201209

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 46     gatttttacacagctctgtaaagag 70
              |||||| ||||||||||||||||||
Sbjct: 142539 gattttgacacagctctgtaaagag 142563

to top

>gb|AC163729.5| Pan troglodytes BAC clone CH251-1018P19 from chromosome y, complete
            sequence
          Length = 196073

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 46   gatttttacacagctctgtaaagag 70
            |||||| ||||||||||||||||||
Sbjct: 8644 gattttgacacagctctgtaaagag 8620

to top

>gb|AC110544.13| Mus musculus chromosome 3, clone RP23-112A11, complete sequence
          Length = 201027

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 68    gaggaattccaggctgattt 87
             ||||||||||||||||||||
Sbjct: 81475 gaggaattccaggctgattt 81494

to top

>ref|XM_632452.1| Dictyostelium discoideum hypothetical protein (DDB0187019), partial
            mRNA
          Length = 2169

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   aatatcataaaatcaccaaa 110
            ||||||||||||||||||||
Sbjct: 2083 aatatcataaaatcaccaaa 2102

to top

>gb|BC100406.1| Mus musculus similar to Hypothetical protein DJ1198H6.2, mRNA (cDNA
            clone MGC:118154 IMAGE:30727972), complete cds
          Length = 2090

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  cagtcagcccctttgtctcc 361
            ||||||||||||||||||||
Sbjct: 1613 cagtcagcccctttgtctcc 1594

to top

>ref|NM_001034101.1| Mus musculus similar to Hypothetical protein DJ1198H6.2 (MGC118154),
            mRNA
          Length = 2090

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  cagtcagcccctttgtctcc 361
            ||||||||||||||||||||
Sbjct: 1613 cagtcagcccctttgtctcc 1594

to top

>ref|XM_891538.2| PREDICTED: Mus musculus similar to PRAME family member DJ1198H6.2
            (LOC626922), mRNA
          Length = 2064

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  cagtcagcccctttgtctcc 361
            ||||||||||||||||||||
Sbjct: 1610 cagtcagcccctttgtctcc 1591

to top

>ref|XM_285846.6| PREDICTED: Mus musculus similar to PRAME family member DJ1198H6.2
            (LOC329984), mRNA
          Length = 2052

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  cagtcagcccctttgtctcc 361
            ||||||||||||||||||||
Sbjct: 1588 cagtcagcccctttgtctcc 1569

to top

>emb|CR392350.11| Zebrafish DNA sequence from clone DKEY-61N21 in linkage group 5,
             complete sequence
          Length = 230648

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 35    atcaataaagagatttttacacag 58
             ||||||||||||||||||| ||||
Sbjct: 97831 atcaataaagagatttttaaacag 97854



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 35    atcaataaagagatttttacacag 58
             ||||||||||||||||||| ||||
Sbjct: 89438 atcaataaagagatttttaaacag 89461

to top

>gb|AF545855.1| Rattus norvegicus cryptochrome 1 mRNA, complete cds
          Length = 2495

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 346  cagcccctttgtctcccttc 365
            ||||||||||||||||||||
Sbjct: 2415 cagcccctttgtctcccttc 2434

to top

>emb|AL035603.11|HS179E13 Human DNA sequence from clone RP1-179E13 on chromosome 6q22.1-22.33
             Contains ribosomal protein S4, X-linked (cell cycle gene
             2, single-copy abundant mRNA, ribosomal protein S4X
             variant, 40S ribosomal protein S4, X variant)
             (RPS4X)(CCG2, SCAR, SCR10, DXS306) pseudogene, complete
             sequence
          Length = 138443

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 449   ttcagtatccacaggccttg 468
             ||||||||||||||||||||
Sbjct: 39522 ttcagtatccacaggccttg 39503

to top

>emb|AL672236.18| Mouse DNA sequence from clone RP23-206L21 on chromosome 11 Contains a
             ribosomal protein S6 (Rps6) pseudogene, a novel gene, the
             gene for a novel immunoglobulin domain containing protein
             and two CpG islands, complete sequence
          Length = 219893

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    tttttagcatcaataaagag 46
             ||||||||||||||||||||
Sbjct: 41615 tttttagcatcaataaagag 41634

to top

>gb|AC087865.8| Homo sapiens 12 BAC RP11-66D24 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 169045

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 111  atttgttgaattgaagaatggaccctgg 138
            |||||||||||| ||||||| |||||||
Sbjct: 8108 atttgttgaattaaagaatgaaccctgg 8135

to top

>emb|BX640523.14| Zebrafish DNA sequence from clone CH211-271E10 in linkage group 5,
            complete sequence
          Length = 107704

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 35   atcaataaagagatttttacacag 58
            ||||||||||||||||||| ||||
Sbjct: 9805 atcaataaagagatttttaaacag 9828

to top

>dbj|AB234024.1| Paralichthys olivaceus TLR9 gene for Toll-like receptor 9, complete
            cds
          Length = 4683

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 428  cttgatctttactattctag 447
            ||||||||||||||||||||
Sbjct: 2190 cttgatctttactattctag 2209

to top

>dbj|AB234023.1| Paralichthys olivaceus TLR9 mRNA for Toll-like receptor 9, complete
            cds
          Length = 3637

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 428  cttgatctttactattctag 447
            ||||||||||||||||||||
Sbjct: 1743 cttgatctttactattctag 1762

to top

>gb|AC010020.7| Drosophila melanogaster 3L BAC RP98-26I3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 166857

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    ccaaaatttgttgaattgaa 125
              ||||||||||||||||||||
Sbjct: 104966 ccaaaatttgttgaattgaa 104985

to top

>gb|AC091516.8| Homo sapiens 12q BAC RP11-474L23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 158998

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 111    atttgttgaattgaagaatggaccctgg 138
              |||||||||||| ||||||| |||||||
Sbjct: 133862 atttgttgaattaaagaatgaaccctgg 133835

to top

>emb|AL928630.15| Mouse DNA sequence from clone RP23-33P17 on chromosome 4, complete
             sequence
          Length = 202295

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 342   cagtcagcccctttgtctcc 361
             ||||||||||||||||||||
Sbjct: 29085 cagtcagcccctttgtctcc 29104



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 342   cagtcagcccctttgtctcc 361
             ||||||||||||||||||||
Sbjct: 13149 cagtcagcccctttgtctcc 13168

to top

>emb|BX005061.9| Zebrafish DNA sequence from clone CH211-158F5 in linkage group 5,
              complete sequence
          Length = 155854

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 172    taatgttacaattcatttgtacatttgt 199
              ||||||||||||| ||||||| ||||||
Sbjct: 129773 taatgttacaatttatttgtagatttgt 129746

to top

>gb|AC109638.2| Homo sapiens BAC clone RP11-495B16 from 2, complete sequence
          Length = 104787

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 155   aaaaagggtgaatgcactaa 174
             ||||||||||||||||||||
Sbjct: 58737 aaaaagggtgaatgcactaa 58756

to top

>gb|AC073606.19| Homo sapiens 12 BAC RP11-390N6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 145430

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    catcaataaagagattttta 53
             ||||||||||||||||||||
Sbjct: 71775 catcaataaagagattttta 71794

to top

>gb|AE003554.3| Drosophila melanogaster chromosome 3L, section 31 of 83 of the complete
              sequence
          Length = 285158

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 106    ccaaaatttgttgaattgaa 125
              ||||||||||||||||||||
Sbjct: 111085 ccaaaatttgttgaattgaa 111066

to top

>gb|AC091272.12| Mus musculus chromosome 1, clone RP23-74B7, complete sequence
          Length = 252476

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 50     tttacacagctctgtaaaga 69
              ||||||||||||||||||||
Sbjct: 170906 tttacacagctctgtaaaga 170925

to top

>emb|AL954311.13| Zebrafish DNA sequence from clone CH211-138M12 in linkage group 5,
              complete sequence
          Length = 168421

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 35     atcaataaagagatttttacacag 58
              ||||||||||||||||||| ||||
Sbjct: 154924 atcaataaagagatttttaaacag 154901



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 35     atcaataaagagatttttacacag 58
              ||||||||||||||||||| ||||
Sbjct: 139586 atcaataaagagatttttaaacag 139563

to top

>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 108     aaaatttgttgaattgaaga 127
               ||||||||||||||||||||
Sbjct: 1814260 aaaatttgttgaattgaaga 1814241

to top

>emb|AL626771.9| Mouse DNA sequence from clone RP23-281O10 on chromosome 4, complete
            sequence
          Length = 185594

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 342  cagtcagcccctttgtctcc 361
            ||||||||||||||||||||
Sbjct: 9088 cagtcagcccctttgtctcc 9069

to top

>emb|X02497.1|DMCHORSG D.melanogaster chorion genes s18-1, s15-1 and s19-1
          Length = 4797

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  ccaaaatttgttgaattgaa 125
            ||||||||||||||||||||
Sbjct: 1934 ccaaaatttgttgaattgaa 1915

to top

>emb|X06257.1|DMS18S15 Drosophila chorion genes s18-1 and s15-1
          Length = 3850

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 106  ccaaaatttgttgaattgaa 125
            ||||||||||||||||||||
Sbjct: 2793 ccaaaatttgttgaattgaa 2774

to top

>emb|AL606926.6| Mouse DNA sequence from clone RP23-231M4 on chromosome 4, complete
             sequence
          Length = 93508

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 342   cagtcagcccctttgtctcc 361
             ||||||||||||||||||||
Sbjct: 40640 cagtcagcccctttgtctcc 40621


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,534,047
Number of Sequences: 3902068
Number of extensions: 5534047
Number of successful extensions: 115691
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 115445
Number of HSP's gapped (non-prelim): 246
length of query: 471
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 449
effective length of database: 17,147,199,772
effective search space: 7699092697628
effective search space used: 7699092697628
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result